Multiple sequence alignment - TraesCS6D01G150800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G150800 chr6D 100.000 2440 0 0 1 2440 124519124 124516685 0 4506
1 TraesCS6D01G150800 chr7D 99.345 2442 14 1 1 2440 381925603 381923162 0 4420
2 TraesCS6D01G150800 chr7D 99.304 2442 13 3 1 2440 382051681 382049242 0 4412
3 TraesCS6D01G150800 chr7D 99.222 2442 16 3 1 2440 203501601 203499161 0 4401
4 TraesCS6D01G150800 chr7D 99.180 2440 13 2 1 2440 381972168 381974600 0 4388
5 TraesCS6D01G150800 chr5A 99.183 2447 13 4 1 2440 19247241 19249687 0 4401
6 TraesCS6D01G150800 chr7A 98.895 2443 24 2 1 2440 60280915 60278473 0 4359
7 TraesCS6D01G150800 chr7B 98.895 2444 20 4 1 2440 716877179 716879619 0 4357
8 TraesCS6D01G150800 chr7B 98.732 2445 25 4 1 2440 742991047 742988604 0 4338
9 TraesCS6D01G150800 chr2B 98.364 2445 33 5 1 2440 112842637 112840195 0 4287


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G150800 chr6D 124516685 124519124 2439 True 4506 4506 100.000 1 2440 1 chr6D.!!$R1 2439
1 TraesCS6D01G150800 chr7D 381923162 381925603 2441 True 4420 4420 99.345 1 2440 1 chr7D.!!$R2 2439
2 TraesCS6D01G150800 chr7D 382049242 382051681 2439 True 4412 4412 99.304 1 2440 1 chr7D.!!$R3 2439
3 TraesCS6D01G150800 chr7D 203499161 203501601 2440 True 4401 4401 99.222 1 2440 1 chr7D.!!$R1 2439
4 TraesCS6D01G150800 chr7D 381972168 381974600 2432 False 4388 4388 99.180 1 2440 1 chr7D.!!$F1 2439
5 TraesCS6D01G150800 chr5A 19247241 19249687 2446 False 4401 4401 99.183 1 2440 1 chr5A.!!$F1 2439
6 TraesCS6D01G150800 chr7A 60278473 60280915 2442 True 4359 4359 98.895 1 2440 1 chr7A.!!$R1 2439
7 TraesCS6D01G150800 chr7B 716877179 716879619 2440 False 4357 4357 98.895 1 2440 1 chr7B.!!$F1 2439
8 TraesCS6D01G150800 chr7B 742988604 742991047 2443 True 4338 4338 98.732 1 2440 1 chr7B.!!$R1 2439
9 TraesCS6D01G150800 chr2B 112840195 112842637 2442 True 4287 4287 98.364 1 2440 1 chr2B.!!$R1 2439

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
674 675 0.336737 ATTGAGTCCGAGGGAGAGGT 59.663 55.0 0.0 0.0 29.39 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1569 1572 1.89622 TCGTTTCTGCTTCTGCCAAT 58.104 45.0 0.0 0.0 38.71 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
82 83 2.481795 GCCCAACGACCTATAACGCTAA 60.482 50.000 0.00 0.0 0.00 3.09
386 387 4.385825 GTTCCACATGAGAAACCAGTACA 58.614 43.478 0.00 0.0 0.00 2.90
597 598 4.397417 GCAATAGAAAGGAATGCTGTCACT 59.603 41.667 0.00 0.0 34.29 3.41
674 675 0.336737 ATTGAGTCCGAGGGAGAGGT 59.663 55.000 0.00 0.0 29.39 3.85
1569 1572 4.319133 GGCGAGGCCTTCATTTCA 57.681 55.556 6.77 0.0 46.69 2.69
2041 2062 4.039603 AGTCAATAGGCAGGCTTCTTTT 57.960 40.909 0.00 0.0 0.00 2.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
33 34 3.073274 AGGTTGCCATGAGTAAGGTTC 57.927 47.619 0.0 0.0 0.00 3.62
386 387 9.052759 GTTCGATTGGACATGTAGGTTATATTT 57.947 33.333 0.0 0.0 0.00 1.40
674 675 1.228429 CGAGCCCCAAGAAAACCCA 60.228 57.895 0.0 0.0 0.00 4.51
1569 1572 1.896220 TCGTTTCTGCTTCTGCCAAT 58.104 45.000 0.0 0.0 38.71 3.16
2041 2062 8.394877 CGGTGAAAATGAATATGTTTGCTACTA 58.605 33.333 0.0 0.0 0.00 1.82
2357 2378 2.340731 TGCCTACCTTACCCACTTGAA 58.659 47.619 0.0 0.0 0.00 2.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.