Multiple sequence alignment - TraesCS6D01G147000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G147000 chr6D 100.000 2546 0 0 1 2546 119199466 119202011 0.000000e+00 4702
1 TraesCS6D01G147000 chr6D 96.667 2550 74 5 1 2546 386197542 386200084 0.000000e+00 4228
2 TraesCS6D01G147000 chr4D 98.508 2547 33 5 1 2546 481022880 481025422 0.000000e+00 4488
3 TraesCS6D01G147000 chr4D 95.804 2550 101 3 1 2546 476027108 476024561 0.000000e+00 4111
4 TraesCS6D01G147000 chr4B 98.076 2547 47 2 1 2546 497377298 497374753 0.000000e+00 4431
5 TraesCS6D01G147000 chr2B 95.251 2548 117 3 1 2546 288127304 288124759 0.000000e+00 4032
6 TraesCS6D01G147000 chr3A 96.450 2282 62 6 1 2278 748668868 748666602 0.000000e+00 3747
7 TraesCS6D01G147000 chr3A 96.363 2282 64 6 1 2278 748463145 748460879 0.000000e+00 3736
8 TraesCS6D01G147000 chr3A 96.233 2283 65 8 1 2278 748747347 748745081 0.000000e+00 3720
9 TraesCS6D01G147000 chr3A 96.012 2282 72 6 1 2278 748555352 748553086 0.000000e+00 3692
10 TraesCS6D01G147000 chr3B 98.018 454 9 0 2093 2546 172178356 172177903 0.000000e+00 789
11 TraesCS6D01G147000 chr3B 85.202 223 30 3 2327 2546 730754060 730754282 2.550000e-55 226
12 TraesCS6D01G147000 chr3B 96.581 117 4 0 2093 2209 679638370 679638486 7.190000e-46 195
13 TraesCS6D01G147000 chr2A 85.586 222 30 2 2327 2546 706867388 706867609 5.480000e-57 231


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G147000 chr6D 119199466 119202011 2545 False 4702 4702 100.000 1 2546 1 chr6D.!!$F1 2545
1 TraesCS6D01G147000 chr6D 386197542 386200084 2542 False 4228 4228 96.667 1 2546 1 chr6D.!!$F2 2545
2 TraesCS6D01G147000 chr4D 481022880 481025422 2542 False 4488 4488 98.508 1 2546 1 chr4D.!!$F1 2545
3 TraesCS6D01G147000 chr4D 476024561 476027108 2547 True 4111 4111 95.804 1 2546 1 chr4D.!!$R1 2545
4 TraesCS6D01G147000 chr4B 497374753 497377298 2545 True 4431 4431 98.076 1 2546 1 chr4B.!!$R1 2545
5 TraesCS6D01G147000 chr2B 288124759 288127304 2545 True 4032 4032 95.251 1 2546 1 chr2B.!!$R1 2545
6 TraesCS6D01G147000 chr3A 748666602 748668868 2266 True 3747 3747 96.450 1 2278 1 chr3A.!!$R3 2277
7 TraesCS6D01G147000 chr3A 748460879 748463145 2266 True 3736 3736 96.363 1 2278 1 chr3A.!!$R1 2277
8 TraesCS6D01G147000 chr3A 748745081 748747347 2266 True 3720 3720 96.233 1 2278 1 chr3A.!!$R4 2277
9 TraesCS6D01G147000 chr3A 748553086 748555352 2266 True 3692 3692 96.012 1 2278 1 chr3A.!!$R2 2277

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
837 840 1.273838 ACTTCTGGCATCCCTCCTACA 60.274 52.381 0.0 0.0 0.0 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2193 2207 4.453478 CACAGTTGTGTCATGCATAGAACT 59.547 41.667 0.0 1.39 40.96 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
54 55 7.237471 AGTCCCTTTGGTTCATATTTTTGGATT 59.763 33.333 0.00 0.00 0.00 3.01
837 840 1.273838 ACTTCTGGCATCCCTCCTACA 60.274 52.381 0.00 0.00 0.00 2.74
1117 1120 7.031372 TGCATCTGTTATGAAAGAAGCAATTC 58.969 34.615 5.20 0.00 42.34 2.17
1609 1616 4.284829 TGTATCTGAGTGCATCAACCAA 57.715 40.909 0.00 0.00 37.52 3.67
1742 1749 3.181483 CCATGCTTAGAATGAAGGCAACC 60.181 47.826 0.87 0.00 36.49 3.77
2040 2053 3.440522 GGCTTATCCACACTTGAAAGACC 59.559 47.826 0.00 0.00 34.01 3.85
2193 2207 5.069914 ACGTATGCATCTATTGGTCAACCTA 59.930 40.000 0.19 0.00 36.82 3.08
2437 2451 4.437682 TCATGTCCCTGACTTTCAAAGT 57.562 40.909 1.21 1.21 46.38 2.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
54 55 9.304335 TGTCATATAGAAATCGATACAGGGTAA 57.696 33.333 0.00 0.00 0.00 2.85
595 598 1.059584 TGCCTTCTTCCACCACTCCA 61.060 55.000 0.00 0.00 0.00 3.86
837 840 4.380531 CACTTGATATTAGTGCGGTGGAT 58.619 43.478 6.13 0.00 36.88 3.41
1117 1120 2.795329 ACCTTCTATTGCACCACAAGG 58.205 47.619 10.74 10.74 42.87 3.61
1609 1616 7.255590 CCCAACTGTCACAATACTTCTCAAATT 60.256 37.037 0.00 0.00 0.00 1.82
1742 1749 7.576236 ACAAGTCATGAAGTTCAAAGAATACG 58.424 34.615 10.14 7.93 0.00 3.06
1850 1858 7.831691 TTGGGTTCTTCTATTTGATTCACAA 57.168 32.000 0.00 0.00 36.65 3.33
2193 2207 4.453478 CACAGTTGTGTCATGCATAGAACT 59.547 41.667 0.00 1.39 40.96 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.