Multiple sequence alignment - TraesCS6D01G140300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G140300 chr6D 100.000 2549 0 0 1 2549 109962641 109965189 0 4708
1 TraesCS6D01G140300 chr6D 96.945 1964 48 6 591 2549 52521727 52519771 0 3284
2 TraesCS6D01G140300 chr6D 90.068 584 34 14 1 571 426875328 426874756 0 736
3 TraesCS6D01G140300 chr1D 97.136 1990 50 7 564 2549 26486128 26488114 0 3352
4 TraesCS6D01G140300 chr5D 96.888 1992 54 6 562 2549 336262614 336264601 0 3328
5 TraesCS6D01G140300 chr2D 96.179 1989 61 7 570 2549 238958884 238960866 0 3238
6 TraesCS6D01G140300 chr2D 95.411 2005 77 11 555 2549 331197162 331199161 0 3179
7 TraesCS6D01G140300 chr2D 90.468 577 46 7 1 571 75054206 75054779 0 752
8 TraesCS6D01G140300 chr2D 90.227 573 44 9 1 571 268568680 268569242 0 737
9 TraesCS6D01G140300 chr2D 88.676 574 54 8 1 571 479035028 479034463 0 689
10 TraesCS6D01G140300 chr7D 96.165 1982 64 5 572 2549 574727118 574725145 0 3229
11 TraesCS6D01G140300 chr3A 95.464 1984 80 8 572 2549 735555341 735557320 0 3157
12 TraesCS6D01G140300 chr6B 95.320 1987 82 7 570 2549 660437745 660435763 0 3144
13 TraesCS6D01G140300 chr7A 95.138 1995 86 8 563 2549 701581932 701583923 0 3136
14 TraesCS6D01G140300 chr3D 90.484 578 42 8 1 571 537836104 537836675 0 750
15 TraesCS6D01G140300 chr3D 87.500 576 54 15 1 571 500293853 500293291 0 649
16 TraesCS6D01G140300 chr4D 89.501 581 44 11 1 571 223724943 223725516 0 719
17 TraesCS6D01G140300 chr5A 87.586 580 58 8 1 571 322652735 322652161 0 660
18 TraesCS6D01G140300 chr1A 87.047 579 63 7 1 571 192876706 192876132 0 643


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G140300 chr6D 109962641 109965189 2548 False 4708 4708 100.000 1 2549 1 chr6D.!!$F1 2548
1 TraesCS6D01G140300 chr6D 52519771 52521727 1956 True 3284 3284 96.945 591 2549 1 chr6D.!!$R1 1958
2 TraesCS6D01G140300 chr6D 426874756 426875328 572 True 736 736 90.068 1 571 1 chr6D.!!$R2 570
3 TraesCS6D01G140300 chr1D 26486128 26488114 1986 False 3352 3352 97.136 564 2549 1 chr1D.!!$F1 1985
4 TraesCS6D01G140300 chr5D 336262614 336264601 1987 False 3328 3328 96.888 562 2549 1 chr5D.!!$F1 1987
5 TraesCS6D01G140300 chr2D 238958884 238960866 1982 False 3238 3238 96.179 570 2549 1 chr2D.!!$F2 1979
6 TraesCS6D01G140300 chr2D 331197162 331199161 1999 False 3179 3179 95.411 555 2549 1 chr2D.!!$F4 1994
7 TraesCS6D01G140300 chr2D 75054206 75054779 573 False 752 752 90.468 1 571 1 chr2D.!!$F1 570
8 TraesCS6D01G140300 chr2D 268568680 268569242 562 False 737 737 90.227 1 571 1 chr2D.!!$F3 570
9 TraesCS6D01G140300 chr2D 479034463 479035028 565 True 689 689 88.676 1 571 1 chr2D.!!$R1 570
10 TraesCS6D01G140300 chr7D 574725145 574727118 1973 True 3229 3229 96.165 572 2549 1 chr7D.!!$R1 1977
11 TraesCS6D01G140300 chr3A 735555341 735557320 1979 False 3157 3157 95.464 572 2549 1 chr3A.!!$F1 1977
12 TraesCS6D01G140300 chr6B 660435763 660437745 1982 True 3144 3144 95.320 570 2549 1 chr6B.!!$R1 1979
13 TraesCS6D01G140300 chr7A 701581932 701583923 1991 False 3136 3136 95.138 563 2549 1 chr7A.!!$F1 1986
14 TraesCS6D01G140300 chr3D 537836104 537836675 571 False 750 750 90.484 1 571 1 chr3D.!!$F1 570
15 TraesCS6D01G140300 chr3D 500293291 500293853 562 True 649 649 87.500 1 571 1 chr3D.!!$R1 570
16 TraesCS6D01G140300 chr4D 223724943 223725516 573 False 719 719 89.501 1 571 1 chr4D.!!$F1 570
17 TraesCS6D01G140300 chr5A 322652161 322652735 574 True 660 660 87.586 1 571 1 chr5A.!!$R1 570
18 TraesCS6D01G140300 chr1A 192876132 192876706 574 True 643 643 87.047 1 571 1 chr1A.!!$R1 570

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
938 972 1.754621 CTAGCTCTGGAGGGCGTGA 60.755 63.158 0.0 0.0 0.0 4.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2412 2455 3.577805 AAACCAAGTGCCACTCTAACT 57.422 42.857 0.0 0.0 0.0 2.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
71 72 4.474113 GTCTGAGGTAAACTACTCACACG 58.526 47.826 0.00 0.00 38.71 4.49
257 259 9.136828 TGGGTATATATAGGAGGAAGAAGTACT 57.863 37.037 0.00 0.00 0.00 2.73
343 356 2.344203 CCTCGTGGCTTCCTCGTCT 61.344 63.158 7.12 0.00 40.72 4.18
352 365 1.871080 CTTCCTCGTCTGTTGCTTGT 58.129 50.000 0.00 0.00 0.00 3.16
447 466 7.095187 GGACTCCGTTTGATATAAATAGGCAAG 60.095 40.741 0.00 0.00 0.00 4.01
938 972 1.754621 CTAGCTCTGGAGGGCGTGA 60.755 63.158 0.00 0.00 0.00 4.35
1068 1102 2.632377 CGTGTGGACATGCCTATCTTT 58.368 47.619 7.54 0.00 37.63 2.52
1340 1374 3.049674 CATGCTGCCACGAACGGT 61.050 61.111 0.00 0.00 0.00 4.83
1514 1548 3.738830 TGTAGGTATGGTAATCGCACC 57.261 47.619 0.00 0.00 39.20 5.01
1999 2041 6.616947 TCCAATTCAAATACACCGTGATTTC 58.383 36.000 5.28 0.00 0.00 2.17
2174 2217 1.031029 GCGACTAGGGACTCGAACCT 61.031 60.000 4.79 7.94 41.75 3.50
2328 2371 1.656875 TGAATGTTTGCACACGCGC 60.657 52.632 5.73 0.00 42.97 6.86
2412 2455 1.618487 TGCACTGCCACATGATTTCA 58.382 45.000 0.00 0.00 0.00 2.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
71 72 1.000283 CACCATAGCCTCTCCGATGAC 60.000 57.143 0.00 0.00 0.00 3.06
136 137 1.800229 ATCTTGGGGCCTTTTCCGGT 61.800 55.000 0.84 0.00 0.00 5.28
257 259 2.342279 CCTCGTTGCTCCACCGAA 59.658 61.111 0.00 0.00 0.00 4.30
343 356 0.531974 GGAGTGGACGACAAGCAACA 60.532 55.000 0.00 0.00 0.00 3.33
352 365 0.112606 AGAGGACTTGGAGTGGACGA 59.887 55.000 0.00 0.00 0.00 4.20
416 429 7.931578 ATTTATATCAAACGGAGTCCAAACA 57.068 32.000 10.49 0.00 45.00 2.83
862 888 4.427661 GCCGTGCTCTCTGTCGCT 62.428 66.667 0.00 0.00 0.00 4.93
938 972 1.913762 ACAGCTAGCTTCCCACCGT 60.914 57.895 16.46 5.02 0.00 4.83
1063 1097 0.670546 CACCGCGGACAGACAAAGAT 60.671 55.000 35.90 0.00 0.00 2.40
1086 1120 4.514577 CTCCGATCAACGCCCGCT 62.515 66.667 0.00 0.00 41.07 5.52
1340 1374 4.435436 CTCGTGCTGCGGCCACTA 62.435 66.667 16.57 4.72 41.72 2.74
1361 1395 1.207791 GCCCTCCATCTCTTCTTCCA 58.792 55.000 0.00 0.00 0.00 3.53
1514 1548 7.309177 TCCATACATTTTCAACATTACAACCG 58.691 34.615 0.00 0.00 0.00 4.44
1999 2041 6.457355 TCCATGACATTTTGGTCTTTGATTG 58.543 36.000 0.00 0.00 38.61 2.67
2328 2371 4.632538 AAACAAAGGAAAACCACTCTCG 57.367 40.909 0.00 0.00 0.00 4.04
2412 2455 3.577805 AAACCAAGTGCCACTCTAACT 57.422 42.857 0.00 0.00 0.00 2.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.