Multiple sequence alignment - TraesCS6D01G139600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G139600 chr6D 100.000 2192 0 0 1 2192 108485209 108487400 0 4048
1 TraesCS6D01G139600 chr3A 97.993 2192 44 0 1 2192 495104759 495102568 0 3805
2 TraesCS6D01G139600 chr2B 97.810 2192 48 0 1 2192 234541159 234538968 0 3783
3 TraesCS6D01G139600 chr1A 97.719 2192 49 1 1 2192 278521195 278523385 0 3770
4 TraesCS6D01G139600 chrUn 97.673 2192 50 1 1 2192 217907669 217909859 0 3764
5 TraesCS6D01G139600 chr3B 97.673 2192 50 1 1 2192 6010765 6008575 0 3764
6 TraesCS6D01G139600 chr3B 97.630 2194 47 3 1 2192 92296731 92294541 0 3759
7 TraesCS6D01G139600 chr1B 97.536 2192 53 1 1 2192 619195330 619193140 0 3747
8 TraesCS6D01G139600 chr4A 97.400 2192 57 0 1 2192 67519499 67521690 0 3733
9 TraesCS6D01G139600 chr7A 97.263 2192 60 0 1 2192 563522097 563519906 0 3716


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G139600 chr6D 108485209 108487400 2191 False 4048 4048 100.000 1 2192 1 chr6D.!!$F1 2191
1 TraesCS6D01G139600 chr3A 495102568 495104759 2191 True 3805 3805 97.993 1 2192 1 chr3A.!!$R1 2191
2 TraesCS6D01G139600 chr2B 234538968 234541159 2191 True 3783 3783 97.810 1 2192 1 chr2B.!!$R1 2191
3 TraesCS6D01G139600 chr1A 278521195 278523385 2190 False 3770 3770 97.719 1 2192 1 chr1A.!!$F1 2191
4 TraesCS6D01G139600 chrUn 217907669 217909859 2190 False 3764 3764 97.673 1 2192 1 chrUn.!!$F1 2191
5 TraesCS6D01G139600 chr3B 6008575 6010765 2190 True 3764 3764 97.673 1 2192 1 chr3B.!!$R1 2191
6 TraesCS6D01G139600 chr3B 92294541 92296731 2190 True 3759 3759 97.630 1 2192 1 chr3B.!!$R2 2191
7 TraesCS6D01G139600 chr1B 619193140 619195330 2190 True 3747 3747 97.536 1 2192 1 chr1B.!!$R1 2191
8 TraesCS6D01G139600 chr4A 67519499 67521690 2191 False 3733 3733 97.400 1 2192 1 chr4A.!!$F1 2191
9 TraesCS6D01G139600 chr7A 563519906 563522097 2191 True 3716 3716 97.263 1 2192 1 chr7A.!!$R1 2191

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
908 909 1.005984 TCGCCAAATTCGTCGACCA 60.006 52.632 10.58 0.0 0.0 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1947 1950 0.602638 TTGTGCCAGTAGCCAACTCG 60.603 55.0 0.0 0.0 42.71 4.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
319 320 8.974060 AAACAACGATTAGTGGATATTGGTAT 57.026 30.769 0.00 0.00 0.00 2.73
477 478 5.566623 CATGCATATGTTGTCAGTGAAGAC 58.433 41.667 0.00 0.00 38.99 3.01
586 587 6.408548 CCAGTCAAAGATTCCTATTCTAGGCA 60.409 42.308 0.00 0.00 45.82 4.75
623 624 3.370527 CCTTCGAATGGTGTTGGTCCTAT 60.371 47.826 0.00 0.00 0.00 2.57
810 811 4.905456 TGGGTAGAGGAAGTCTCAAAAAGA 59.095 41.667 0.00 0.00 44.81 2.52
823 824 2.301870 TCAAAAAGAGAAGGCCGAGCTA 59.698 45.455 0.00 0.00 0.00 3.32
906 907 1.058903 GCTCGCCAAATTCGTCGAC 59.941 57.895 5.18 5.18 0.00 4.20
908 909 1.005984 TCGCCAAATTCGTCGACCA 60.006 52.632 10.58 0.00 0.00 4.02
1019 1020 4.527038 CCTTATGTTTAGGAGCGGGATCTA 59.473 45.833 0.00 0.00 34.56 1.98
1038 1039 1.052124 ACCCAAGAACGACCTGTGGA 61.052 55.000 0.00 0.00 0.00 4.02
1126 1127 7.097192 TCACAAGATAAAGAAGTATGACGCTT 58.903 34.615 0.00 0.00 0.00 4.68
1512 1515 3.111853 AGAGATGCGACAAAGTGTTCA 57.888 42.857 0.00 0.00 0.00 3.18
1675 1678 2.096248 CCGAGACTCAGGTTAAGCTCT 58.904 52.381 3.68 0.00 0.00 4.09
1689 1692 2.995872 GCTCTGTCTCGGAACCGCT 61.996 63.158 8.48 0.00 39.59 5.52
1714 1717 2.508300 GGGTTAGGAGTAAAGCATCCCA 59.492 50.000 0.00 0.00 36.14 4.37
1753 1756 1.397390 GGCATGGAGAAGCATTGGGG 61.397 60.000 0.00 0.00 0.00 4.96
1789 1792 2.930826 TCGGAGCAGTTTCTTTTCCT 57.069 45.000 0.00 0.00 0.00 3.36
1947 1950 3.197983 AGGATAACTAAGCTGACACACCC 59.802 47.826 0.00 0.00 0.00 4.61
2154 2157 3.935024 AGCTATCGCTTCGGGTCA 58.065 55.556 0.00 0.00 46.47 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
207 208 7.179160 TGTGGAGGAATCAATATCTCGACATAT 59.821 37.037 0.00 0.0 39.06 1.78
319 320 1.031029 TGCTTGCTGTGCAGTGACAA 61.031 50.000 0.00 0.0 40.61 3.18
477 478 2.291741 GTCTCCAAGGCTTCACACAAAG 59.708 50.000 0.00 0.0 0.00 2.77
533 534 2.094906 ACACATTCGCTCACTTACGCTA 60.095 45.455 0.00 0.0 0.00 4.26
586 587 2.567664 GAAGGTTAATGGCCCGCCCT 62.568 60.000 0.00 0.0 34.56 5.19
598 599 3.404899 GACCAACACCATTCGAAGGTTA 58.595 45.455 14.28 0.0 37.23 2.85
810 811 1.133450 TGACCTATAGCTCGGCCTTCT 60.133 52.381 0.00 0.0 0.00 2.85
852 853 0.839853 AGGAGAAAGCCCAGTCAGCT 60.840 55.000 0.00 0.0 44.19 4.24
1019 1020 1.052124 TCCACAGGTCGTTCTTGGGT 61.052 55.000 0.00 0.0 0.00 4.51
1038 1039 2.283388 TCCGTGCCTTCCGTACCT 60.283 61.111 0.00 0.0 0.00 3.08
1126 1127 5.745312 ATGACCAATAGAGTCAGACACAA 57.255 39.130 2.66 0.0 46.76 3.33
1240 1241 0.177141 TTTCCCTTCATACGGCTCGG 59.823 55.000 0.00 0.0 0.00 4.63
1675 1678 2.338620 CACAGCGGTTCCGAGACA 59.661 61.111 15.69 0.0 0.00 3.41
1689 1692 2.340731 TGCTTTACTCCTAACCCCACA 58.659 47.619 0.00 0.0 0.00 4.17
1714 1717 1.302511 AACGAGATGCGCCAACCTT 60.303 52.632 4.18 0.0 46.04 3.50
1753 1756 4.381411 CTCCGAAGAAAGATATTGGGGTC 58.619 47.826 0.00 0.0 0.00 4.46
1947 1950 0.602638 TTGTGCCAGTAGCCAACTCG 60.603 55.000 0.00 0.0 42.71 4.18
2154 2157 4.037565 CCGGTCCTTTTCTTTTAGTGCTTT 59.962 41.667 0.00 0.0 0.00 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.