Multiple sequence alignment - TraesCS6D01G139400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G139400 chr6D 100.000 2843 0 0 1 2843 108464348 108467190 0.000000e+00 5251
1 TraesCS6D01G139400 chr6D 97.487 796 18 1 2049 2842 57919866 57920661 0.000000e+00 1358
2 TraesCS6D01G139400 chr2D 98.735 2846 31 5 1 2843 637321130 637318287 0.000000e+00 5051
3 TraesCS6D01G139400 chr2D 97.779 1981 39 5 1 1979 39496945 39498922 0.000000e+00 3410
4 TraesCS6D01G139400 chr2D 91.765 170 11 3 1889 2056 429476983 429476815 1.700000e-57 233
5 TraesCS6D01G139400 chr2D 97.590 83 1 1 1975 2056 39500657 39500739 1.060000e-29 141
6 TraesCS6D01G139400 chr7D 98.279 2848 29 6 1 2843 579026374 579029206 0.000000e+00 4970
7 TraesCS6D01G139400 chr7D 99.020 102 0 1 1967 2067 606866649 606866548 6.260000e-42 182
8 TraesCS6D01G139400 chr7D 100.000 75 0 0 1979 2053 606872726 606872652 3.820000e-29 139
9 TraesCS6D01G139400 chr3D 97.863 1965 36 6 1 1964 523759615 523761574 0.000000e+00 3391
10 TraesCS6D01G139400 chr5A 98.639 1910 23 3 1 1908 73031591 73033499 0.000000e+00 3380
11 TraesCS6D01G139400 chr1B 98.533 1909 26 2 1 1908 638750010 638748103 0.000000e+00 3369
12 TraesCS6D01G139400 chr7A 98.428 1909 24 4 1 1908 60106997 60105094 0.000000e+00 3354
13 TraesCS6D01G139400 chr3B 97.957 1909 37 2 1 1908 575754724 575752817 0.000000e+00 3308
14 TraesCS6D01G139400 chr3B 97.484 795 17 3 2049 2842 39815071 39815863 0.000000e+00 1354
15 TraesCS6D01G139400 chr2B 97.800 1909 40 2 1 1908 500714118 500716025 0.000000e+00 3291
16 TraesCS6D01G139400 chr2B 97.358 795 20 1 2049 2843 357277252 357276459 0.000000e+00 1351
17 TraesCS6D01G139400 chr4D 98.491 795 11 1 2049 2843 123738965 123738172 0.000000e+00 1400
18 TraesCS6D01G139400 chr4D 98.239 795 14 0 2049 2843 123656168 123655374 0.000000e+00 1391
19 TraesCS6D01G139400 chr4D 97.990 796 15 1 2049 2843 123509470 123508675 0.000000e+00 1380
20 TraesCS6D01G139400 chr7B 97.733 794 18 0 2049 2842 139543497 139542704 0.000000e+00 1367
21 TraesCS6D01G139400 chr5D 97.080 137 3 1 1921 2056 469489542 469489678 2.200000e-56 230


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G139400 chr6D 108464348 108467190 2842 False 5251.0 5251 100.0000 1 2843 1 chr6D.!!$F2 2842
1 TraesCS6D01G139400 chr6D 57919866 57920661 795 False 1358.0 1358 97.4870 2049 2842 1 chr6D.!!$F1 793
2 TraesCS6D01G139400 chr2D 637318287 637321130 2843 True 5051.0 5051 98.7350 1 2843 1 chr2D.!!$R2 2842
3 TraesCS6D01G139400 chr2D 39496945 39500739 3794 False 1775.5 3410 97.6845 1 2056 2 chr2D.!!$F1 2055
4 TraesCS6D01G139400 chr7D 579026374 579029206 2832 False 4970.0 4970 98.2790 1 2843 1 chr7D.!!$F1 2842
5 TraesCS6D01G139400 chr3D 523759615 523761574 1959 False 3391.0 3391 97.8630 1 1964 1 chr3D.!!$F1 1963
6 TraesCS6D01G139400 chr5A 73031591 73033499 1908 False 3380.0 3380 98.6390 1 1908 1 chr5A.!!$F1 1907
7 TraesCS6D01G139400 chr1B 638748103 638750010 1907 True 3369.0 3369 98.5330 1 1908 1 chr1B.!!$R1 1907
8 TraesCS6D01G139400 chr7A 60105094 60106997 1903 True 3354.0 3354 98.4280 1 1908 1 chr7A.!!$R1 1907
9 TraesCS6D01G139400 chr3B 575752817 575754724 1907 True 3308.0 3308 97.9570 1 1908 1 chr3B.!!$R1 1907
10 TraesCS6D01G139400 chr3B 39815071 39815863 792 False 1354.0 1354 97.4840 2049 2842 1 chr3B.!!$F1 793
11 TraesCS6D01G139400 chr2B 500714118 500716025 1907 False 3291.0 3291 97.8000 1 1908 1 chr2B.!!$F1 1907
12 TraesCS6D01G139400 chr2B 357276459 357277252 793 True 1351.0 1351 97.3580 2049 2843 1 chr2B.!!$R1 794
13 TraesCS6D01G139400 chr4D 123738172 123738965 793 True 1400.0 1400 98.4910 2049 2843 1 chr4D.!!$R3 794
14 TraesCS6D01G139400 chr4D 123655374 123656168 794 True 1391.0 1391 98.2390 2049 2843 1 chr4D.!!$R2 794
15 TraesCS6D01G139400 chr4D 123508675 123509470 795 True 1380.0 1380 97.9900 2049 2843 1 chr4D.!!$R1 794
16 TraesCS6D01G139400 chr7B 139542704 139543497 793 True 1367.0 1367 97.7330 2049 2842 1 chr7B.!!$R1 793

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
656 662 1.588674 AGATCACCGCGTGAACAAAA 58.411 45.0 13.81 0.0 45.96 2.44 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1917 1938 0.402504 ATTAAACCACAGTGCCGGGA 59.597 50.0 2.18 0.0 0.0 5.14 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
152 153 5.104562 AGCGACGAAATATACGAGATCAA 57.895 39.130 0.00 0.00 34.70 2.57
547 552 2.752354 CTCTCGGATCGGAGATGCTAAT 59.248 50.000 27.39 0.00 45.12 1.73
656 662 1.588674 AGATCACCGCGTGAACAAAA 58.411 45.000 13.81 0.00 45.96 2.44
1006 1025 1.230212 CCACTTTAGGGGATGGGGC 59.770 63.158 0.00 0.00 0.00 5.80
1792 1813 4.359434 TGGTACTGGCATTTTGTAGACA 57.641 40.909 0.00 0.00 0.00 3.41
1917 1938 1.784358 TCTCCGGGTAATTGGATCGT 58.216 50.000 0.00 0.00 32.83 3.73
2098 3860 1.153429 GTTCAGATTCCCCGGGTCG 60.153 63.158 21.85 4.79 0.00 4.79
2125 3887 1.271054 CCATGGCCGCTTAGCTTAGAT 60.271 52.381 3.38 0.00 0.00 1.98
2432 4197 4.871822 TGATGAGGAGTGAGGTAGATTCA 58.128 43.478 0.00 0.00 0.00 2.57
2555 4321 2.959357 GCAAGTGCGGCTCAGTCAC 61.959 63.158 0.00 0.00 0.00 3.67
2592 4358 3.617263 GCATGAAGTAAGTTGTCGGTAGG 59.383 47.826 0.00 0.00 0.00 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
152 153 0.719465 CCGCGAGCAATCTACGTTTT 59.281 50.000 8.23 0.00 0.00 2.43
326 328 5.179555 AGAAATGCGAAAGAACTCAACTACC 59.820 40.000 0.00 0.00 0.00 3.18
547 552 0.613260 CCACTTCGATTCCTGTCCCA 59.387 55.000 0.00 0.00 0.00 4.37
656 662 4.935808 GGAGTGACATTCGTTACTTTGGAT 59.064 41.667 0.00 0.00 41.70 3.41
726 732 2.744202 GCACTCCGTCTTGAACATGAAT 59.256 45.455 0.00 0.00 0.00 2.57
737 743 1.115930 ACAACCTCAGCACTCCGTCT 61.116 55.000 0.00 0.00 0.00 4.18
739 745 0.249911 GAACAACCTCAGCACTCCGT 60.250 55.000 0.00 0.00 0.00 4.69
1228 1247 2.835156 TGGATTCACGTAGAACATCCCA 59.165 45.455 13.26 10.50 39.49 4.37
1792 1813 4.349365 ACAAATGGGAATAACCGAACCAT 58.651 39.130 0.00 0.00 43.39 3.55
1917 1938 0.402504 ATTAAACCACAGTGCCGGGA 59.597 50.000 2.18 0.00 0.00 5.14
2098 3860 2.337879 TAAGCGGCCATGGACCCATC 62.338 60.000 18.40 0.16 33.90 3.51
2125 3887 5.118990 GCATTCATGTCTCTAACAAGGCTA 58.881 41.667 0.00 0.00 42.37 3.93
2217 3980 4.543692 CTCAACATTCTTTCCACAGCAAG 58.456 43.478 0.00 0.00 0.00 4.01
2432 4197 5.499139 TTCTTCGCTTTCTTCAACAATGT 57.501 34.783 0.00 0.00 0.00 2.71
2592 4358 4.421058 CTTTTCCTTTTACCTAATGCCGC 58.579 43.478 0.00 0.00 0.00 6.53


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.