Multiple sequence alignment - TraesCS6D01G139300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G139300 chr6D 100.000 2318 0 0 1 2318 108463447 108465764 0.000000e+00 4281
1 TraesCS6D01G139300 chr6D 97.500 120 3 0 305 424 169248843 169248962 3.020000e-49 206
2 TraesCS6D01G139300 chr7D 98.106 2323 24 6 1 2318 579025472 579027779 0.000000e+00 4028
3 TraesCS6D01G139300 chr5A 98.466 1890 25 4 432 2318 73031120 73033008 0.000000e+00 3326
4 TraesCS6D01G139300 chr7A 98.412 1889 27 3 432 2318 60107468 60105581 0.000000e+00 3319
5 TraesCS6D01G139300 chr7A 98.639 441 6 0 1 441 4917693 4917253 0.000000e+00 782
6 TraesCS6D01G139300 chr2D 98.201 1890 29 5 432 2318 637321601 637319714 0.000000e+00 3297
7 TraesCS6D01G139300 chr1B 98.147 1889 32 3 432 2318 638750481 638748594 0.000000e+00 3291
8 TraesCS6D01G139300 chr1B 98.361 427 7 0 1 427 339032257 339031831 0.000000e+00 750
9 TraesCS6D01G139300 chr3D 97.777 1889 36 6 432 2318 523759144 523761028 0.000000e+00 3251
10 TraesCS6D01G139300 chr2B 97.512 1889 44 3 432 2318 500713647 500715534 0.000000e+00 3225
11 TraesCS6D01G139300 chr3B 97.455 1886 45 3 435 2318 575755192 575753308 0.000000e+00 3214
12 TraesCS6D01G139300 chr6B 97.247 1889 48 4 432 2318 388368104 388366218 0.000000e+00 3197
13 TraesCS6D01G139300 chr1D 98.969 582 6 0 1 582 493809965 493809384 0.000000e+00 1042
14 TraesCS6D01G139300 chr6A 98.413 441 7 0 1 441 608886893 608886453 0.000000e+00 776
15 TraesCS6D01G139300 chr6A 96.825 441 14 0 1 441 413559128 413559568 0.000000e+00 737
16 TraesCS6D01G139300 chr1A 99.361 313 2 0 1 313 22568747 22569059 3.340000e-158 568
17 TraesCS6D01G139300 chr7B 99.042 313 3 0 1 313 716871158 716871470 1.560000e-156 562
18 TraesCS6D01G139300 chr7B 99.042 313 3 0 1 313 716902074 716902386 1.560000e-156 562


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G139300 chr6D 108463447 108465764 2317 False 4281 4281 100.000 1 2318 1 chr6D.!!$F1 2317
1 TraesCS6D01G139300 chr7D 579025472 579027779 2307 False 4028 4028 98.106 1 2318 1 chr7D.!!$F1 2317
2 TraesCS6D01G139300 chr5A 73031120 73033008 1888 False 3326 3326 98.466 432 2318 1 chr5A.!!$F1 1886
3 TraesCS6D01G139300 chr7A 60105581 60107468 1887 True 3319 3319 98.412 432 2318 1 chr7A.!!$R2 1886
4 TraesCS6D01G139300 chr2D 637319714 637321601 1887 True 3297 3297 98.201 432 2318 1 chr2D.!!$R1 1886
5 TraesCS6D01G139300 chr1B 638748594 638750481 1887 True 3291 3291 98.147 432 2318 1 chr1B.!!$R2 1886
6 TraesCS6D01G139300 chr3D 523759144 523761028 1884 False 3251 3251 97.777 432 2318 1 chr3D.!!$F1 1886
7 TraesCS6D01G139300 chr2B 500713647 500715534 1887 False 3225 3225 97.512 432 2318 1 chr2B.!!$F1 1886
8 TraesCS6D01G139300 chr3B 575753308 575755192 1884 True 3214 3214 97.455 435 2318 1 chr3B.!!$R1 1883
9 TraesCS6D01G139300 chr6B 388366218 388368104 1886 True 3197 3197 97.247 432 2318 1 chr6B.!!$R1 1886
10 TraesCS6D01G139300 chr1D 493809384 493809965 581 True 1042 1042 98.969 1 582 1 chr1D.!!$R1 581

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
710 711 1.173913 CCATTCTTGGGGTCCGAAAC 58.826 55.0 0.0 0.0 39.56 2.78 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1640 1648 0.249911 GAACAACCTCAGCACTCCGT 60.25 55.0 0.0 0.0 0.0 4.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
238 239 2.508300 ACCAAGTAAAGGTGCCGGATAT 59.492 45.455 5.05 0.0 38.13 1.63
668 669 1.693799 AGGGGCCCCTATTTTCAAGA 58.306 50.000 43.85 0.0 46.14 3.02
710 711 1.173913 CCATTCTTGGGGTCCGAAAC 58.826 55.000 0.00 0.0 39.56 2.78
797 799 9.831737 CTATTTTTGGTCAGAATCTTTACAGTG 57.168 33.333 0.00 0.0 0.00 3.66
1053 1055 5.104562 AGCGACGAAATATACGAGATCAA 57.895 39.130 0.00 0.0 34.70 2.57
1338 1344 4.159557 AGCAACCACCAAACCAATAGAAT 58.840 39.130 0.00 0.0 0.00 2.40
1448 1454 2.752354 CTCTCGGATCGGAGATGCTAAT 59.248 50.000 27.39 0.0 45.12 1.73
1907 1915 1.230212 CCACTTTAGGGGATGGGGC 59.770 63.158 0.00 0.0 0.00 5.80
2237 2245 3.838903 AGTCTCGGAGGTTATGTTCCTTT 59.161 43.478 4.96 0.0 35.20 3.11
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
26 27 5.292101 ACTTGCATCTATTTCAACTAGACGC 59.708 40.000 0.00 0.00 35.54 5.19
238 239 2.549563 CCTTTCAAGCTGAGCTGAGACA 60.550 50.000 8.16 1.61 39.62 3.41
348 349 7.845952 TCATATTGTGAGGCGGATCATAAGATC 60.846 40.741 0.00 0.00 39.95 2.75
573 574 9.954763 CCAAATTGGATTCTGAAATCAGAGGCG 62.955 44.444 6.04 0.00 46.28 5.52
668 669 3.396260 TGGATCGAAACGACTTTCCTT 57.604 42.857 11.61 0.00 39.18 3.36
751 752 1.134220 GTACATTCCATGCCCTCGGAA 60.134 52.381 0.00 0.00 45.12 4.30
772 773 9.567776 TCACTGTAAAGATTCTGACCAAAAATA 57.432 29.630 0.00 0.00 0.00 1.40
1053 1055 0.719465 CCGCGAGCAATCTACGTTTT 59.281 50.000 8.23 0.00 0.00 2.43
1227 1230 5.179555 AGAAATGCGAAAGAACTCAACTACC 59.820 40.000 0.00 0.00 0.00 3.18
1448 1454 0.613260 CCACTTCGATTCCTGTCCCA 59.387 55.000 0.00 0.00 0.00 4.37
1627 1635 2.744202 GCACTCCGTCTTGAACATGAAT 59.256 45.455 0.00 0.00 0.00 2.57
1638 1646 1.115930 ACAACCTCAGCACTCCGTCT 61.116 55.000 0.00 0.00 0.00 4.18
1640 1648 0.249911 GAACAACCTCAGCACTCCGT 60.250 55.000 0.00 0.00 0.00 4.69
2129 2137 2.835156 TGGATTCACGTAGAACATCCCA 59.165 45.455 13.26 10.50 39.49 4.37


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.