Multiple sequence alignment - TraesCS6D01G128200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G128200 chr6D 100.000 5259 0 0 1 5259 93260219 93254961 0.000000e+00 9712
1 TraesCS6D01G128200 chr6D 98.293 4746 35 5 1 4732 286469848 286465135 0.000000e+00 8274
2 TraesCS6D01G128200 chr6D 95.845 1444 53 3 3816 5259 469743288 469741852 0.000000e+00 2327
3 TraesCS6D01G128200 chr4D 97.942 5199 74 5 64 5259 369863739 369868907 0.000000e+00 8977
4 TraesCS6D01G128200 chr4D 98.489 4170 55 4 64 4225 249078025 249082194 0.000000e+00 7345
5 TraesCS6D01G128200 chr4D 98.296 3991 53 8 64 4045 97425849 97429833 0.000000e+00 6979
6 TraesCS6D01G128200 chr4D 97.163 1445 34 3 3816 5259 249081850 249083288 0.000000e+00 2435
7 TraesCS6D01G128200 chr4D 97.545 1385 26 4 3882 5259 369884381 369885764 0.000000e+00 2362
8 TraesCS6D01G128200 chr4D 97.401 1385 28 4 3882 5259 369852180 369850797 0.000000e+00 2351
9 TraesCS6D01G128200 chr4D 100.000 101 0 0 1 101 97425755 97425855 2.500000e-43 187
10 TraesCS6D01G128200 chr4D 100.000 101 0 0 1 101 249077931 249078031 2.500000e-43 187
11 TraesCS6D01G128200 chr7D 98.060 4742 81 7 525 5259 576677565 576682302 0.000000e+00 8237
12 TraesCS6D01G128200 chr7D 96.961 1415 36 4 3851 5259 254134618 254136031 0.000000e+00 2368
13 TraesCS6D01G128200 chr7D 100.000 101 0 0 1 101 178479642 178479742 2.500000e-43 187
14 TraesCS6D01G128200 chr2D 98.433 4020 51 9 64 4075 628654133 628650118 0.000000e+00 7064
15 TraesCS6D01G128200 chr2D 97.373 609 11 3 64 668 643708007 643708614 0.000000e+00 1031
16 TraesCS6D01G128200 chr2D 100.000 101 0 0 1 101 96767640 96767740 2.500000e-43 187
17 TraesCS6D01G128200 chr2D 100.000 101 0 0 1 101 507474750 507474850 2.500000e-43 187
18 TraesCS6D01G128200 chr2D 100.000 101 0 0 1 101 643707913 643708013 2.500000e-43 187
19 TraesCS6D01G128200 chr2D 99.010 101 1 0 1 101 545780115 545780015 1.160000e-41 182
20 TraesCS6D01G128200 chr2D 99.010 101 1 0 1 101 615578808 615578908 1.160000e-41 182
21 TraesCS6D01G128200 chr1D 98.234 4020 61 7 64 4075 212704412 212700395 0.000000e+00 7022
22 TraesCS6D01G128200 chr1D 96.753 616 15 3 64 675 211559972 211560586 0.000000e+00 1022
23 TraesCS6D01G128200 chr1D 100.000 101 0 0 1 101 212704506 212704406 2.500000e-43 187
24 TraesCS6D01G128200 chr3D 98.137 3919 60 7 228 4135 523176977 523180893 0.000000e+00 6820
25 TraesCS6D01G128200 chr3D 98.113 1378 25 1 3882 5259 121312879 121314255 0.000000e+00 2399
26 TraesCS6D01G128200 chr5D 98.380 3827 50 8 228 4045 528529464 528533287 0.000000e+00 6713
27 TraesCS6D01G128200 chr5D 97.471 1384 28 3 3882 5259 135669926 135668544 0.000000e+00 2355


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G128200 chr6D 93254961 93260219 5258 True 9712.000000 9712 100.000000 1 5259 1 chr6D.!!$R1 5258
1 TraesCS6D01G128200 chr6D 286465135 286469848 4713 True 8274.000000 8274 98.293000 1 4732 1 chr6D.!!$R2 4731
2 TraesCS6D01G128200 chr6D 469741852 469743288 1436 True 2327.000000 2327 95.845000 3816 5259 1 chr6D.!!$R3 1443
3 TraesCS6D01G128200 chr4D 369863739 369868907 5168 False 8977.000000 8977 97.942000 64 5259 1 chr4D.!!$F1 5195
4 TraesCS6D01G128200 chr4D 97425755 97429833 4078 False 3583.000000 6979 99.148000 1 4045 2 chr4D.!!$F3 4044
5 TraesCS6D01G128200 chr4D 249077931 249083288 5357 False 3322.333333 7345 98.550667 1 5259 3 chr4D.!!$F4 5258
6 TraesCS6D01G128200 chr4D 369884381 369885764 1383 False 2362.000000 2362 97.545000 3882 5259 1 chr4D.!!$F2 1377
7 TraesCS6D01G128200 chr4D 369850797 369852180 1383 True 2351.000000 2351 97.401000 3882 5259 1 chr4D.!!$R1 1377
8 TraesCS6D01G128200 chr7D 576677565 576682302 4737 False 8237.000000 8237 98.060000 525 5259 1 chr7D.!!$F3 4734
9 TraesCS6D01G128200 chr7D 254134618 254136031 1413 False 2368.000000 2368 96.961000 3851 5259 1 chr7D.!!$F2 1408
10 TraesCS6D01G128200 chr2D 628650118 628654133 4015 True 7064.000000 7064 98.433000 64 4075 1 chr2D.!!$R2 4011
11 TraesCS6D01G128200 chr2D 643707913 643708614 701 False 609.000000 1031 98.686500 1 668 2 chr2D.!!$F4 667
12 TraesCS6D01G128200 chr1D 212700395 212704506 4111 True 3604.500000 7022 99.117000 1 4075 2 chr1D.!!$R1 4074
13 TraesCS6D01G128200 chr1D 211559972 211560586 614 False 1022.000000 1022 96.753000 64 675 1 chr1D.!!$F1 611
14 TraesCS6D01G128200 chr3D 523176977 523180893 3916 False 6820.000000 6820 98.137000 228 4135 1 chr3D.!!$F2 3907
15 TraesCS6D01G128200 chr3D 121312879 121314255 1376 False 2399.000000 2399 98.113000 3882 5259 1 chr3D.!!$F1 1377
16 TraesCS6D01G128200 chr5D 528529464 528533287 3823 False 6713.000000 6713 98.380000 228 4045 1 chr5D.!!$F1 3817
17 TraesCS6D01G128200 chr5D 135668544 135669926 1382 True 2355.000000 2355 97.471000 3882 5259 1 chr5D.!!$R1 1377

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
679 739 2.231964 CCATAACAAGCAATGCCACACT 59.768 45.455 0.00 0.0 0.0 3.55 F
1377 1446 0.834687 AGGGTGGCTACGAAGGACAA 60.835 55.000 0.00 0.0 0.0 3.18 F
2063 2133 1.597742 GAAGTGAAGGCAGTGCAGAA 58.402 50.000 18.61 0.0 0.0 3.02 F
2415 2485 2.955660 TCAAGACGGCCAAAATCAAGTT 59.044 40.909 2.24 0.0 0.0 2.66 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2415 2485 0.469705 AAGCAAATGCCAGTGGGACA 60.470 50.000 12.15 0.96 43.38 4.02 R
2802 2872 1.073763 ACTGCTTCAACATGTGCCCTA 59.926 47.619 0.00 0.00 0.00 3.53 R
3384 3455 3.897505 AGCAAGGTAGGTGAAGCAATTTT 59.102 39.130 0.00 0.00 0.00 1.82 R
4413 5063 3.146104 ACTGTCTCCCATTTCAACCAG 57.854 47.619 0.00 0.00 0.00 4.00 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
62 94 8.583810 AGTATACGTAAATATTTGTGTGCGAT 57.416 30.769 11.05 3.21 0.00 4.58
679 739 2.231964 CCATAACAAGCAATGCCACACT 59.768 45.455 0.00 0.00 0.00 3.55
1072 1141 3.771216 ACAAATGAGTTGGGAGCAGATT 58.229 40.909 0.00 0.00 41.97 2.40
1377 1446 0.834687 AGGGTGGCTACGAAGGACAA 60.835 55.000 0.00 0.00 0.00 3.18
2016 2086 4.630069 ACGCTTATTGCTCGACTGTTTTAT 59.370 37.500 0.00 0.00 40.11 1.40
2063 2133 1.597742 GAAGTGAAGGCAGTGCAGAA 58.402 50.000 18.61 0.00 0.00 3.02
2415 2485 2.955660 TCAAGACGGCCAAAATCAAGTT 59.044 40.909 2.24 0.00 0.00 2.66
3153 3223 2.995939 CAGACGTCAAATAGCAGAGCAA 59.004 45.455 19.50 0.00 0.00 3.91
3730 3801 0.923358 TCCCACTTTTGTCACTGGGT 59.077 50.000 0.00 0.00 34.54 4.51
3876 3947 7.865385 TGTTCTGAAATTTGTATTAAGTGTGGC 59.135 33.333 0.00 0.00 0.00 5.01
3878 3949 7.367285 TCTGAAATTTGTATTAAGTGTGGCAC 58.633 34.615 11.55 11.55 34.10 5.01
3880 3951 8.397575 TGAAATTTGTATTAAGTGTGGCACTA 57.602 30.769 19.83 2.23 44.62 2.74
3881 3952 9.019656 TGAAATTTGTATTAAGTGTGGCACTAT 57.980 29.630 19.83 7.37 44.62 2.12
3882 3953 9.289303 GAAATTTGTATTAAGTGTGGCACTATG 57.711 33.333 19.83 0.00 44.62 2.23
3883 3954 7.938140 ATTTGTATTAAGTGTGGCACTATGT 57.062 32.000 19.83 4.16 44.62 2.29
3885 3956 6.978343 TGTATTAAGTGTGGCACTATGTTC 57.022 37.500 19.83 3.65 44.62 3.18
4129 4569 9.456147 TTTATTAAGTGTGGCACTATGTTATGT 57.544 29.630 19.83 6.04 44.62 2.29
4413 5063 4.880886 TGCACACTGACATGCATATTAC 57.119 40.909 0.00 0.00 46.63 1.89
4450 5100 6.643360 GGAGACAGTAACTGAAAAGTTCTCTC 59.357 42.308 0.00 0.00 35.18 3.20
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1377 1446 3.445008 TCCTCCTTCTACATGACTGCTT 58.555 45.455 0.00 0.00 0.00 3.91
1892 1962 3.844211 TGTGCCATACTTAGGGAGAAAGT 59.156 43.478 0.00 0.00 40.25 2.66
2016 2086 3.632643 TTGCCTTGCACTATCTCATCA 57.367 42.857 0.00 0.00 38.71 3.07
2063 2133 2.096248 TCAACCTGGCGAACACTTTTT 58.904 42.857 0.00 0.00 0.00 1.94
2415 2485 0.469705 AAGCAAATGCCAGTGGGACA 60.470 50.000 12.15 0.96 43.38 4.02
2710 2780 9.037737 GCGTATCAAATTGTACTTCCATAACTA 57.962 33.333 0.00 0.00 0.00 2.24
2802 2872 1.073763 ACTGCTTCAACATGTGCCCTA 59.926 47.619 0.00 0.00 0.00 3.53
3153 3223 7.361713 CGTGTATTTGGGTTGTTCAAGATATGT 60.362 37.037 0.00 0.00 0.00 2.29
3384 3455 3.897505 AGCAAGGTAGGTGAAGCAATTTT 59.102 39.130 0.00 0.00 0.00 1.82
3730 3801 4.308458 CCGGTTGCCTCGTCCACA 62.308 66.667 0.00 0.00 0.00 4.17
3880 3951 9.912634 CCACACTTAATACAAATTTCAGAACAT 57.087 29.630 0.00 0.00 0.00 2.71
3881 3952 7.865385 GCCACACTTAATACAAATTTCAGAACA 59.135 33.333 0.00 0.00 0.00 3.18
3882 3953 7.865385 TGCCACACTTAATACAAATTTCAGAAC 59.135 33.333 0.00 0.00 0.00 3.01
3883 3954 7.865385 GTGCCACACTTAATACAAATTTCAGAA 59.135 33.333 0.00 0.00 0.00 3.02
3885 3956 7.370383 AGTGCCACACTTAATACAAATTTCAG 58.630 34.615 0.00 0.00 42.59 3.02
4413 5063 3.146104 ACTGTCTCCCATTTCAACCAG 57.854 47.619 0.00 0.00 0.00 4.00
4450 5100 1.135024 CGGCCCATTTCAACCTTCATG 60.135 52.381 0.00 0.00 0.00 3.07
4921 5571 0.820871 GGCTCCGAGTGATCTGTTCT 59.179 55.000 0.00 0.00 0.00 3.01
5122 5772 0.323302 TCGATGTAAGCTGGCAACCA 59.677 50.000 0.00 0.00 0.00 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.