Multiple sequence alignment - TraesCS6D01G115500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G115500 chr6D 100.000 2840 0 0 1 2840 82084623 82087462 0.000000e+00 5245
1 TraesCS6D01G115500 chr6D 97.194 1996 48 8 1 1993 82070232 82072222 0.000000e+00 3369
2 TraesCS6D01G115500 chr6D 95.907 1979 68 10 19 1992 349550197 349552167 0.000000e+00 3193
3 TraesCS6D01G115500 chr6D 95.420 262 11 1 1984 2245 82068213 82067953 1.570000e-112 416
4 TraesCS6D01G115500 chr3D 96.130 2248 81 5 1 2245 47688514 47686270 0.000000e+00 3664
5 TraesCS6D01G115500 chr3D 93.966 348 19 2 1893 2239 47698818 47698472 2.510000e-145 525
6 TraesCS6D01G115500 chr4D 95.206 2086 94 5 165 2245 87399614 87401698 0.000000e+00 3293
7 TraesCS6D01G115500 chr4D 90.571 350 26 6 1900 2245 87390121 87390467 9.270000e-125 457
8 TraesCS6D01G115500 chr2D 96.244 1997 67 5 1 1994 38586487 38588478 0.000000e+00 3265
9 TraesCS6D01G115500 chr2D 95.744 1997 74 8 1 1993 38597769 38599758 0.000000e+00 3206
10 TraesCS6D01G115500 chr2D 81.767 532 78 15 2239 2755 73132167 73131640 7.270000e-116 427
11 TraesCS6D01G115500 chr2D 80.316 569 84 23 2252 2805 556231220 556230665 3.410000e-109 405
12 TraesCS6D01G115500 chr1A 95.786 2017 78 5 1 2011 513774403 513772388 0.000000e+00 3247
13 TraesCS6D01G115500 chr5D 95.850 2000 64 9 1 1993 407680635 407678648 0.000000e+00 3216
14 TraesCS6D01G115500 chr5D 82.460 496 70 15 2354 2838 309672882 309672393 4.380000e-113 418
15 TraesCS6D01G115500 chr5D 79.333 600 89 24 2250 2828 498931733 498931148 3.430000e-104 388
16 TraesCS6D01G115500 chr7A 95.092 2017 86 7 1 2011 80553193 80555202 0.000000e+00 3164
17 TraesCS6D01G115500 chr6B 83.388 614 76 18 2243 2840 156926429 156927032 1.920000e-151 545
18 TraesCS6D01G115500 chr1D 92.437 357 23 2 1893 2245 418699995 418699639 9.080000e-140 507
19 TraesCS6D01G115500 chr1D 92.529 348 21 5 1893 2237 418708172 418707827 7.070000e-136 494
20 TraesCS6D01G115500 chr1D 92.771 249 16 1 1993 2239 116460438 116460686 2.690000e-95 359
21 TraesCS6D01G115500 chr4A 91.143 350 25 5 1900 2245 509711489 509711142 1.190000e-128 470
22 TraesCS6D01G115500 chr1B 82.070 541 75 19 2247 2772 40988523 40989056 2.600000e-120 442
23 TraesCS6D01G115500 chr5A 83.227 471 64 10 2311 2769 111905353 111904886 4.380000e-113 418
24 TraesCS6D01G115500 chr5B 79.328 595 93 24 2250 2828 629082618 629082038 9.540000e-105 390
25 TraesCS6D01G115500 chr5B 79.287 589 92 22 2250 2821 632803790 632804365 4.440000e-103 385


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G115500 chr6D 82084623 82087462 2839 False 5245 5245 100.000 1 2840 1 chr6D.!!$F2 2839
1 TraesCS6D01G115500 chr6D 82070232 82072222 1990 False 3369 3369 97.194 1 1993 1 chr6D.!!$F1 1992
2 TraesCS6D01G115500 chr6D 349550197 349552167 1970 False 3193 3193 95.907 19 1992 1 chr6D.!!$F3 1973
3 TraesCS6D01G115500 chr3D 47686270 47688514 2244 True 3664 3664 96.130 1 2245 1 chr3D.!!$R1 2244
4 TraesCS6D01G115500 chr4D 87399614 87401698 2084 False 3293 3293 95.206 165 2245 1 chr4D.!!$F2 2080
5 TraesCS6D01G115500 chr2D 38586487 38588478 1991 False 3265 3265 96.244 1 1994 1 chr2D.!!$F1 1993
6 TraesCS6D01G115500 chr2D 38597769 38599758 1989 False 3206 3206 95.744 1 1993 1 chr2D.!!$F2 1992
7 TraesCS6D01G115500 chr2D 73131640 73132167 527 True 427 427 81.767 2239 2755 1 chr2D.!!$R1 516
8 TraesCS6D01G115500 chr2D 556230665 556231220 555 True 405 405 80.316 2252 2805 1 chr2D.!!$R2 553
9 TraesCS6D01G115500 chr1A 513772388 513774403 2015 True 3247 3247 95.786 1 2011 1 chr1A.!!$R1 2010
10 TraesCS6D01G115500 chr5D 407678648 407680635 1987 True 3216 3216 95.850 1 1993 1 chr5D.!!$R2 1992
11 TraesCS6D01G115500 chr5D 498931148 498931733 585 True 388 388 79.333 2250 2828 1 chr5D.!!$R3 578
12 TraesCS6D01G115500 chr7A 80553193 80555202 2009 False 3164 3164 95.092 1 2011 1 chr7A.!!$F1 2010
13 TraesCS6D01G115500 chr6B 156926429 156927032 603 False 545 545 83.388 2243 2840 1 chr6B.!!$F1 597
14 TraesCS6D01G115500 chr1B 40988523 40989056 533 False 442 442 82.070 2247 2772 1 chr1B.!!$F1 525
15 TraesCS6D01G115500 chr5B 629082038 629082618 580 True 390 390 79.328 2250 2828 1 chr5B.!!$R1 578
16 TraesCS6D01G115500 chr5B 632803790 632804365 575 False 385 385 79.287 2250 2821 1 chr5B.!!$F1 571

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
472 475 4.625607 ACTTAGCAAAGTTAGCAGGACT 57.374 40.909 0.0 0.0 43.6 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2148 2168 1.689959 CTTTCTTCACGTGGCATTGC 58.31 50.0 17.0 0.0 0.0 3.56 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
255 257 7.447238 TCTTTCGAAAGGTAGAACAAAATGGAT 59.553 33.333 31.82 0.00 36.67 3.41
472 475 4.625607 ACTTAGCAAAGTTAGCAGGACT 57.374 40.909 0.00 0.00 43.60 3.85
663 667 6.471198 GCGATACTAAAACAAAAGCCCAATAC 59.529 38.462 0.00 0.00 0.00 1.89
1924 1941 8.760980 ACCCGAATATTGATAGAAATTCCAAA 57.239 30.769 0.00 0.00 0.00 3.28
2048 2068 1.745087 CGCATACACTGGCAAGGATTT 59.255 47.619 0.00 0.00 0.00 2.17
2200 2220 3.758023 TGATGATTGAAGTTTGTCGGCAT 59.242 39.130 0.00 0.00 0.00 4.40
2248 2268 7.801716 ATTAAAAGGACACGCATATACATGT 57.198 32.000 2.69 2.69 34.40 3.21
2315 2425 9.558396 AAATGTTGAACATGTAAATGGAAATGT 57.442 25.926 12.09 0.00 37.97 2.71
2316 2426 9.558396 AATGTTGAACATGTAAATGGAAATGTT 57.442 25.926 12.09 0.00 43.91 2.71
2317 2427 8.362860 TGTTGAACATGTAAATGGAAATGTTG 57.637 30.769 0.00 0.00 41.91 3.33
2318 2428 8.200120 TGTTGAACATGTAAATGGAAATGTTGA 58.800 29.630 0.00 0.00 41.91 3.18
2319 2429 9.039870 GTTGAACATGTAAATGGAAATGTTGAA 57.960 29.630 0.00 0.55 41.91 2.69
2320 2430 9.775854 TTGAACATGTAAATGGAAATGTTGAAT 57.224 25.926 0.00 0.00 41.91 2.57
2421 2532 7.908193 AAAAATGTCGAACAAGTATTCACAC 57.092 32.000 0.00 0.00 0.00 3.82
2431 2606 7.269084 CGAACAAGTATTCACACATGTTGATTC 59.731 37.037 0.00 2.77 32.09 2.52
2433 2608 7.939782 ACAAGTATTCACACATGTTGATTCAA 58.060 30.769 0.00 0.00 0.00 2.69
2469 2644 7.336427 TGTTGAGGAAGCATTTGAAAAATGTTT 59.664 29.630 12.66 12.66 34.51 2.83
2635 2855 4.158579 TGTTGAAATAACATGCGGCCATTA 59.841 37.500 2.24 0.00 0.00 1.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
255 257 9.973661 TTCCATCTTCTTTTTGGATAGTATGAA 57.026 29.630 0.00 0.00 39.22 2.57
613 617 3.584406 CCCATCCTACCTTAGATGCATCA 59.416 47.826 27.81 11.65 0.00 3.07
663 667 3.889815 TCATCTGCTTTTGGGGAGTATG 58.110 45.455 0.00 0.00 0.00 2.39
870 876 2.625639 AGACCCATCTTCTGGTTGAGT 58.374 47.619 0.00 0.00 44.30 3.41
1060 1067 8.851541 AATGTATTTGGCTGAAACATTTTCAT 57.148 26.923 1.94 0.00 37.46 2.57
2003 2023 1.856629 ACATGCCAAGGCTGCTTAAT 58.143 45.000 12.96 0.00 42.51 1.40
2048 2068 5.825593 TCAGAGCTTCTTCTCCCTTAAAA 57.174 39.130 0.00 0.00 33.66 1.52
2051 2071 3.772025 CCTTCAGAGCTTCTTCTCCCTTA 59.228 47.826 0.00 0.00 33.66 2.69
2056 2076 4.464069 TTAGCCTTCAGAGCTTCTTCTC 57.536 45.455 0.00 0.00 41.83 2.87
2148 2168 1.689959 CTTTCTTCACGTGGCATTGC 58.310 50.000 17.00 0.00 0.00 3.56
2181 2201 3.820467 AGAATGCCGACAAACTTCAATCA 59.180 39.130 0.00 0.00 0.00 2.57
2228 2248 7.282224 ACATTTACATGTATATGCGTGTCCTTT 59.718 33.333 26.64 9.26 42.24 3.11
2484 2660 9.988350 ACATTTTTCATATACTCGTTCAACATC 57.012 29.630 0.00 0.00 0.00 3.06
2622 2842 2.694628 ACATTCAATAATGGCCGCATGT 59.305 40.909 0.00 0.00 45.72 3.21
2657 2877 7.566760 ACATTTTCTGTAACAAGTGATCACA 57.433 32.000 27.02 3.53 35.91 3.58


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.