Multiple sequence alignment - TraesCS6D01G111100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G111100 chr6D 100.000 2390 0 0 1 2390 77709365 77711754 0 4414
1 TraesCS6D01G111100 chr6D 90.669 1704 118 32 29 1698 80673638 80671942 0 2228
2 TraesCS6D01G111100 chr2D 94.709 1512 78 2 24 1535 343718326 343716817 0 2348
3 TraesCS6D01G111100 chr2D 95.430 1094 47 3 605 1698 640885784 640884694 0 1740
4 TraesCS6D01G111100 chr2D 94.617 1096 56 3 603 1698 63681691 63682783 0 1694
5 TraesCS6D01G111100 chr7B 90.781 1703 114 12 36 1698 415416450 415418149 0 2235
6 TraesCS6D01G111100 chr7B 89.123 901 63 19 21 889 144748553 144749450 0 1088
7 TraesCS6D01G111100 chr5D 90.173 1730 134 21 1 1698 382034082 382032357 0 2220
8 TraesCS6D01G111100 chr5D 94.617 1096 55 4 605 1698 60521643 60520550 0 1694
9 TraesCS6D01G111100 chr5D 97.533 689 16 1 1700 2388 60500048 60499361 0 1177
10 TraesCS6D01G111100 chr3A 90.442 1695 123 20 36 1698 740091027 740089340 0 2196
11 TraesCS6D01G111100 chr3A 96.952 689 21 0 1700 2388 366874851 366874163 0 1157
12 TraesCS6D01G111100 chr5A 95.465 1367 61 1 332 1698 44872309 44870944 0 2180
13 TraesCS6D01G111100 chr5A 90.006 1691 129 23 42 1698 375870094 375868410 0 2150
14 TraesCS6D01G111100 chr5A 97.110 692 20 0 1697 2388 523625276 523625967 0 1168
15 TraesCS6D01G111100 chr7A 90.053 1689 128 16 42 1698 94446268 94444588 0 2152
16 TraesCS6D01G111100 chr7A 97.254 692 19 0 1697 2388 665982917 665983608 0 1173
17 TraesCS6D01G111100 chr7A 96.839 696 22 0 1693 2388 94440403 94439708 0 1164
18 TraesCS6D01G111100 chr4D 88.844 1748 123 25 1 1697 30903314 30905040 0 2082
19 TraesCS6D01G111100 chr4D 96.830 694 22 0 1695 2388 30908142 30908835 0 1160
20 TraesCS6D01G111100 chr7D 97.118 694 20 0 1695 2388 463980977 463981670 0 1171
21 TraesCS6D01G111100 chr4A 97.242 689 19 0 1700 2388 534185351 534184663 0 1168
22 TraesCS6D01G111100 chr2A 97.110 692 20 0 1697 2388 690347269 690347960 0 1168
23 TraesCS6D01G111100 chr3D 90.630 619 55 3 12 629 34700958 34701574 0 819
24 TraesCS6D01G111100 chr1D 87.354 601 71 4 13 610 422272719 422272121 0 684


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G111100 chr6D 77709365 77711754 2389 False 4414 4414 100.000 1 2390 1 chr6D.!!$F1 2389
1 TraesCS6D01G111100 chr6D 80671942 80673638 1696 True 2228 2228 90.669 29 1698 1 chr6D.!!$R1 1669
2 TraesCS6D01G111100 chr2D 343716817 343718326 1509 True 2348 2348 94.709 24 1535 1 chr2D.!!$R1 1511
3 TraesCS6D01G111100 chr2D 640884694 640885784 1090 True 1740 1740 95.430 605 1698 1 chr2D.!!$R2 1093
4 TraesCS6D01G111100 chr2D 63681691 63682783 1092 False 1694 1694 94.617 603 1698 1 chr2D.!!$F1 1095
5 TraesCS6D01G111100 chr7B 415416450 415418149 1699 False 2235 2235 90.781 36 1698 1 chr7B.!!$F2 1662
6 TraesCS6D01G111100 chr7B 144748553 144749450 897 False 1088 1088 89.123 21 889 1 chr7B.!!$F1 868
7 TraesCS6D01G111100 chr5D 382032357 382034082 1725 True 2220 2220 90.173 1 1698 1 chr5D.!!$R3 1697
8 TraesCS6D01G111100 chr5D 60520550 60521643 1093 True 1694 1694 94.617 605 1698 1 chr5D.!!$R2 1093
9 TraesCS6D01G111100 chr5D 60499361 60500048 687 True 1177 1177 97.533 1700 2388 1 chr5D.!!$R1 688
10 TraesCS6D01G111100 chr3A 740089340 740091027 1687 True 2196 2196 90.442 36 1698 1 chr3A.!!$R2 1662
11 TraesCS6D01G111100 chr3A 366874163 366874851 688 True 1157 1157 96.952 1700 2388 1 chr3A.!!$R1 688
12 TraesCS6D01G111100 chr5A 44870944 44872309 1365 True 2180 2180 95.465 332 1698 1 chr5A.!!$R1 1366
13 TraesCS6D01G111100 chr5A 375868410 375870094 1684 True 2150 2150 90.006 42 1698 1 chr5A.!!$R2 1656
14 TraesCS6D01G111100 chr5A 523625276 523625967 691 False 1168 1168 97.110 1697 2388 1 chr5A.!!$F1 691
15 TraesCS6D01G111100 chr7A 94444588 94446268 1680 True 2152 2152 90.053 42 1698 1 chr7A.!!$R2 1656
16 TraesCS6D01G111100 chr7A 665982917 665983608 691 False 1173 1173 97.254 1697 2388 1 chr7A.!!$F1 691
17 TraesCS6D01G111100 chr7A 94439708 94440403 695 True 1164 1164 96.839 1693 2388 1 chr7A.!!$R1 695
18 TraesCS6D01G111100 chr4D 30903314 30908835 5521 False 1621 2082 92.837 1 2388 2 chr4D.!!$F1 2387
19 TraesCS6D01G111100 chr7D 463980977 463981670 693 False 1171 1171 97.118 1695 2388 1 chr7D.!!$F1 693
20 TraesCS6D01G111100 chr4A 534184663 534185351 688 True 1168 1168 97.242 1700 2388 1 chr4A.!!$R1 688
21 TraesCS6D01G111100 chr2A 690347269 690347960 691 False 1168 1168 97.110 1697 2388 1 chr2A.!!$F1 691
22 TraesCS6D01G111100 chr3D 34700958 34701574 616 False 819 819 90.630 12 629 1 chr3D.!!$F1 617
23 TraesCS6D01G111100 chr1D 422272121 422272719 598 True 684 684 87.354 13 610 1 chr1D.!!$R1 597

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
22 23 1.785951 GCTAGAAACCGCGGTGTTC 59.214 57.895 34.95 31.54 0.0 3.18 F
349 363 1.964223 GAGTAGATCGAAGCATCCCCA 59.036 52.381 0.00 0.00 0.0 4.96 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1357 1435 0.537188 CTGGCGTACCTCTCCACAAT 59.463 55.000 0.00 0.0 36.63 2.71 R
2265 5451 1.297364 GTTTGGCCCATGCATTGCT 59.703 52.632 15.51 0.0 40.13 3.91 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
22 23 1.785951 GCTAGAAACCGCGGTGTTC 59.214 57.895 34.95 31.54 0.00 3.18
349 363 1.964223 GAGTAGATCGAAGCATCCCCA 59.036 52.381 0.00 0.00 0.00 4.96
406 420 9.657419 CCATTTATTTTCAGTTAAGATTGGCTT 57.343 29.630 0.00 0.00 40.68 4.35
588 626 8.971073 AGACCATTATTTTGGATTAGGTTGAAG 58.029 33.333 0.00 0.00 39.25 3.02
644 710 3.181457 TGGTGTTGGTAATGTGGTTCGTA 60.181 43.478 0.00 0.00 0.00 3.43
652 718 7.131498 TGGTAATGTGGTTCGTAATTTGTAC 57.869 36.000 0.00 0.00 0.00 2.90
657 723 6.696441 TGTGGTTCGTAATTTGTACCTTTT 57.304 33.333 7.40 0.00 0.00 2.27
1285 1363 6.579666 TTCATGAAACAAAGAAGGATCCTG 57.420 37.500 17.02 5.62 0.00 3.86
1357 1435 1.957177 CAGAGAATGCTAGTCCGGCTA 59.043 52.381 0.00 0.38 0.00 3.93
1389 1467 1.200519 ACGCCAGGGCTTACTTATGA 58.799 50.000 8.91 0.00 39.32 2.15
1629 1710 3.570125 CGGAGCATGTATGAGGAGTAAGA 59.430 47.826 0.00 0.00 0.00 2.10
1648 1729 4.336889 AGACGAAATCTTGTCTTGGTCA 57.663 40.909 0.00 0.00 42.61 4.02
1653 1734 5.530915 ACGAAATCTTGTCTTGGTCATTTCA 59.469 36.000 0.00 0.00 0.00 2.69
1698 4883 1.215647 GAGCGTATCCCTATGGGCG 59.784 63.158 0.00 0.00 43.94 6.13
1899 5085 0.108186 CGGAGAAGGCTACACATGCA 60.108 55.000 0.00 0.00 0.00 3.96
2030 5216 0.546122 TCCACGGCCTTCAATATGCT 59.454 50.000 0.00 0.00 0.00 3.79
2211 5397 4.406456 TCATGAGTGTGCCCTTGTATTTT 58.594 39.130 0.00 0.00 0.00 1.82
2284 5470 1.003597 GCAATGCATGGGCCAAACA 60.004 52.632 11.89 12.87 40.13 2.83
2299 5485 2.029110 CCAAACATCCAAAAGGCACGAT 60.029 45.455 0.00 0.00 0.00 3.73
2358 5544 5.687166 TTCCTGGGTTTCTATACGACATT 57.313 39.130 0.00 0.00 0.00 2.71
2388 5574 2.747446 CAACCTGGGTAGCATGTTGTAC 59.253 50.000 0.00 0.00 33.42 2.90
2389 5575 1.066430 ACCTGGGTAGCATGTTGTACG 60.066 52.381 0.00 0.00 0.00 3.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
6 7 0.320073 CAGGAACACCGCGGTTTCTA 60.320 55.000 32.48 0.00 34.33 2.10
10 11 3.819877 GACCAGGAACACCGCGGTT 62.820 63.158 32.11 16.90 35.53 4.44
22 23 1.226746 GTGTTTCGGAGTTGACCAGG 58.773 55.000 0.00 0.00 0.00 4.45
349 363 5.249420 GGAAGAGAATACCTCAAGCAACTT 58.751 41.667 0.00 0.00 44.40 2.66
441 456 9.318041 CAAACAAATCACTAATAACTCGTCTTG 57.682 33.333 0.00 0.00 0.00 3.02
657 723 9.871238 GTGAGAGAAACTACTACAAATTATCCA 57.129 33.333 0.00 0.00 0.00 3.41
814 881 1.484240 CTCCCCTCTTTCCACTAGCAG 59.516 57.143 0.00 0.00 0.00 4.24
940 1018 2.515057 GTCACGTGGGTTGTGGCA 60.515 61.111 17.00 0.00 41.49 4.92
1048 1126 1.673626 GGTAATGGCCGTCGAGTTCAA 60.674 52.381 0.00 0.00 0.00 2.69
1285 1363 1.000843 GAACAAAACACCAGATGGCCC 59.999 52.381 0.00 0.00 39.32 5.80
1357 1435 0.537188 CTGGCGTACCTCTCCACAAT 59.463 55.000 0.00 0.00 36.63 2.71
1629 1710 5.530915 TGAAATGACCAAGACAAGATTTCGT 59.469 36.000 0.00 0.00 31.58 3.85
1647 1728 3.364549 TCTGTAGGGCCCAAATGAAATG 58.635 45.455 27.56 3.83 0.00 2.32
1648 1729 3.756082 TCTGTAGGGCCCAAATGAAAT 57.244 42.857 27.56 2.06 0.00 2.17
1653 1734 2.314549 TCCAAATCTGTAGGGCCCAAAT 59.685 45.455 27.56 5.74 0.00 2.32
1698 4883 3.969899 CTTCAACTTTGTCTTGAAGGGC 58.030 45.455 11.47 0.00 45.86 5.19
1899 5085 6.069731 AGGATCTTTGCAAGGATCTTAACTCT 60.070 38.462 36.02 25.64 38.56 3.24
2030 5216 4.306600 CATCATATCCGATCGACACCAAA 58.693 43.478 18.66 0.00 0.00 3.28
2265 5451 1.297364 GTTTGGCCCATGCATTGCT 59.703 52.632 15.51 0.00 40.13 3.91
2284 5470 1.818674 GTTCCATCGTGCCTTTTGGAT 59.181 47.619 0.00 0.00 44.07 3.41
2299 5485 5.250543 TCCAAGATATTGAAGGAGTGTTCCA 59.749 40.000 0.54 0.00 46.64 3.53


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.