Multiple sequence alignment - TraesCS6D01G107400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G107400 chr6D 100.000 2528 0 0 1 2528 71133205 71135732 0.000000e+00 4669
1 TraesCS6D01G107400 chr6D 92.669 1596 99 6 947 2524 71142196 71143791 0.000000e+00 2283
2 TraesCS6D01G107400 chr6B 96.713 1582 52 0 947 2528 145889638 145891219 0.000000e+00 2634
3 TraesCS6D01G107400 chr6B 93.608 704 45 0 947 1650 145897812 145898515 0.000000e+00 1051
4 TraesCS6D01G107400 chr6B 95.015 341 16 1 2184 2524 145898508 145898847 3.700000e-148 534
5 TraesCS6D01G107400 chr6A 90.458 1614 117 12 947 2524 87929419 87931031 0.000000e+00 2093
6 TraesCS6D01G107400 chr3D 88.758 1610 149 15 947 2524 360333534 360335143 0.000000e+00 1941
7 TraesCS6D01G107400 chr3D 98.421 950 15 0 1 950 282136060 282135111 0.000000e+00 1672
8 TraesCS6D01G107400 chr3D 98.316 950 16 0 1 950 79550703 79549754 0.000000e+00 1666
9 TraesCS6D01G107400 chr3D 98.316 950 16 0 1 950 100478324 100477375 0.000000e+00 1666
10 TraesCS6D01G107400 chr3D 86.256 1266 132 22 948 2208 360556960 360558188 0.000000e+00 1336
11 TraesCS6D01G107400 chr3D 90.031 321 30 2 2210 2528 360558291 360558611 5.030000e-112 414
12 TraesCS6D01G107400 chr3B 88.323 1610 151 18 947 2524 466263862 466265466 0.000000e+00 1897
13 TraesCS6D01G107400 chr3B 86.561 1265 128 21 949 2208 466609682 466610909 0.000000e+00 1356
14 TraesCS6D01G107400 chr3B 89.408 321 32 2 2210 2528 466610945 466611265 1.090000e-108 403
15 TraesCS6D01G107400 chr3A 88.199 1610 151 19 947 2524 479771520 479773122 0.000000e+00 1884
16 TraesCS6D01G107400 chr3A 86.468 1611 168 24 948 2524 480049842 480051436 0.000000e+00 1722
17 TraesCS6D01G107400 chr5D 98.737 950 12 0 1 950 191063954 191064903 0.000000e+00 1688
18 TraesCS6D01G107400 chr5D 98.633 951 12 1 1 950 447041457 447042407 0.000000e+00 1683
19 TraesCS6D01G107400 chr5D 98.526 950 14 0 1 950 275917224 275918173 0.000000e+00 1677
20 TraesCS6D01G107400 chr7D 98.632 950 12 1 1 950 257708916 257707968 0.000000e+00 1681
21 TraesCS6D01G107400 chr4D 98.421 950 15 0 1 950 439267362 439266413 0.000000e+00 1672
22 TraesCS6D01G107400 chr1D 98.316 950 16 0 1 950 73185688 73184739 0.000000e+00 1666


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G107400 chr6D 71133205 71135732 2527 False 4669.0 4669 100.0000 1 2528 1 chr6D.!!$F1 2527
1 TraesCS6D01G107400 chr6D 71142196 71143791 1595 False 2283.0 2283 92.6690 947 2524 1 chr6D.!!$F2 1577
2 TraesCS6D01G107400 chr6B 145889638 145891219 1581 False 2634.0 2634 96.7130 947 2528 1 chr6B.!!$F1 1581
3 TraesCS6D01G107400 chr6B 145897812 145898847 1035 False 792.5 1051 94.3115 947 2524 2 chr6B.!!$F2 1577
4 TraesCS6D01G107400 chr6A 87929419 87931031 1612 False 2093.0 2093 90.4580 947 2524 1 chr6A.!!$F1 1577
5 TraesCS6D01G107400 chr3D 360333534 360335143 1609 False 1941.0 1941 88.7580 947 2524 1 chr3D.!!$F1 1577
6 TraesCS6D01G107400 chr3D 282135111 282136060 949 True 1672.0 1672 98.4210 1 950 1 chr3D.!!$R3 949
7 TraesCS6D01G107400 chr3D 79549754 79550703 949 True 1666.0 1666 98.3160 1 950 1 chr3D.!!$R1 949
8 TraesCS6D01G107400 chr3D 100477375 100478324 949 True 1666.0 1666 98.3160 1 950 1 chr3D.!!$R2 949
9 TraesCS6D01G107400 chr3D 360556960 360558611 1651 False 875.0 1336 88.1435 948 2528 2 chr3D.!!$F2 1580
10 TraesCS6D01G107400 chr3B 466263862 466265466 1604 False 1897.0 1897 88.3230 947 2524 1 chr3B.!!$F1 1577
11 TraesCS6D01G107400 chr3B 466609682 466611265 1583 False 879.5 1356 87.9845 949 2528 2 chr3B.!!$F2 1579
12 TraesCS6D01G107400 chr3A 479771520 479773122 1602 False 1884.0 1884 88.1990 947 2524 1 chr3A.!!$F1 1577
13 TraesCS6D01G107400 chr3A 480049842 480051436 1594 False 1722.0 1722 86.4680 948 2524 1 chr3A.!!$F2 1576
14 TraesCS6D01G107400 chr5D 191063954 191064903 949 False 1688.0 1688 98.7370 1 950 1 chr5D.!!$F1 949
15 TraesCS6D01G107400 chr5D 447041457 447042407 950 False 1683.0 1683 98.6330 1 950 1 chr5D.!!$F3 949
16 TraesCS6D01G107400 chr5D 275917224 275918173 949 False 1677.0 1677 98.5260 1 950 1 chr5D.!!$F2 949
17 TraesCS6D01G107400 chr7D 257707968 257708916 948 True 1681.0 1681 98.6320 1 950 1 chr7D.!!$R1 949
18 TraesCS6D01G107400 chr4D 439266413 439267362 949 True 1672.0 1672 98.4210 1 950 1 chr4D.!!$R1 949
19 TraesCS6D01G107400 chr1D 73184739 73185688 949 True 1666.0 1666 98.3160 1 950 1 chr1D.!!$R1 949

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
164 165 2.503061 CGAGTGGGCCCAGAGATG 59.497 66.667 29.55 10.11 0.0 2.9 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1681 1697 0.804364 TGCAGTCTGCCATAAAAGCG 59.196 50.0 21.99 0.0 44.23 4.68 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
84 85 7.464710 GCAAGTCTCTTTACTCGTTCCATAATG 60.465 40.741 0.00 0.00 0.00 1.90
164 165 2.503061 CGAGTGGGCCCAGAGATG 59.497 66.667 29.55 10.11 0.00 2.90
267 268 5.298527 GCACCTTTATAATCACCCAGTTACC 59.701 44.000 0.00 0.00 0.00 2.85
301 302 2.717639 AGCACACAAAGTGTTCCTCT 57.282 45.000 0.00 0.00 45.08 3.69
666 668 5.310409 CCTCTAGGGCATATTTCCTTCAA 57.690 43.478 0.00 0.00 34.75 2.69
970 972 4.016444 TGAAGTGCCCAATTCCTTATCAC 58.984 43.478 6.07 0.00 34.80 3.06
994 996 6.992715 ACAAAGCACTAGTTTGTCAGTTAGAT 59.007 34.615 5.74 0.00 43.12 1.98
1063 1065 3.713764 CAAGAACCCCTCAGGACTATCAT 59.286 47.826 0.00 0.00 39.89 2.45
1201 1204 0.514691 GTTTCTTCTGCTCGGCACTG 59.485 55.000 0.00 0.00 33.79 3.66
1291 1294 3.292492 TCTACGAGCCACCAGATAAGA 57.708 47.619 0.00 0.00 0.00 2.10
1583 1599 1.142870 ACAGTGGTGCACTTGGTACAT 59.857 47.619 17.98 0.00 42.59 2.29
1592 1608 3.070878 TGCACTTGGTACATGACTCTCAA 59.929 43.478 0.00 0.00 39.30 3.02
1653 1669 3.580458 CTGGGCCTTATAGTGCAGTCTAT 59.420 47.826 4.53 0.00 35.24 1.98
1681 1697 5.118990 TCACTAATAGCTGGCTTTGTCATC 58.881 41.667 0.00 0.00 0.00 2.92
1699 1715 1.086696 TCGCTTTTATGGCAGACTGC 58.913 50.000 19.55 19.55 44.08 4.40
2040 2097 1.281867 AGGGCATTCGAAGTGGAATCA 59.718 47.619 3.35 0.00 34.50 2.57
2066 2123 1.269569 GGGCTTGGTTTTGGTTTCTCG 60.270 52.381 0.00 0.00 0.00 4.04
2121 2178 5.590663 TGTTTCTATGTTGGTGCACAGTTTA 59.409 36.000 20.43 0.57 0.00 2.01
2129 2186 3.729966 TGGTGCACAGTTTATACGTCAA 58.270 40.909 20.43 0.00 0.00 3.18
2140 2197 9.367444 ACAGTTTATACGTCAAGGAAAATCTAG 57.633 33.333 0.00 0.00 0.00 2.43
2254 2414 4.911514 TTCCTTGTCTTAGTTTTGGCAC 57.088 40.909 0.00 0.00 0.00 5.01
2314 2474 3.181482 TGCGACAAAAGCAAAGGATTCAA 60.181 39.130 0.00 0.00 42.18 2.69
2328 2488 7.440856 GCAAAGGATTCAACCATTTCTGTTTTA 59.559 33.333 0.00 0.00 0.00 1.52
2421 2581 5.415701 AGGCGACATTGATTTCAGTAATGTT 59.584 36.000 0.00 0.00 43.03 2.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
84 85 1.599542 GAGTTAGTTGCGGGATGATGC 59.400 52.381 0.00 0.00 0.00 3.91
115 116 5.945784 ACATCACTATAAGCCTTGCAAGAAA 59.054 36.000 28.05 9.95 0.00 2.52
117 118 4.877823 CACATCACTATAAGCCTTGCAAGA 59.122 41.667 28.05 8.10 0.00 3.02
267 268 1.937223 TGTGCTACCAAACGTCACAAG 59.063 47.619 1.90 0.00 35.08 3.16
301 302 3.420300 TTATGCAACTCCCGTTTACCA 57.580 42.857 0.00 0.00 0.00 3.25
666 668 2.763448 GACTCTAGTGCAAGTGGGAGAT 59.237 50.000 0.00 0.00 0.00 2.75
935 937 3.539604 GGCACTTCAGAGCATTGTAGAT 58.460 45.455 0.00 0.00 33.19 1.98
970 972 6.844696 TCTAACTGACAAACTAGTGCTTTG 57.155 37.500 0.00 0.00 35.17 2.77
994 996 4.225942 AGAGGAAGCATTAGTCATTGACCA 59.774 41.667 13.14 0.00 32.18 4.02
1120 1122 3.072944 CTGCTTTCTGAAGGGTCTTCTG 58.927 50.000 8.80 8.29 33.34 3.02
1121 1123 2.551938 GCTGCTTTCTGAAGGGTCTTCT 60.552 50.000 8.80 0.00 33.34 2.85
1291 1294 4.096984 CCAAAAGCTAGAATCTTTCCGCAT 59.903 41.667 0.00 0.00 33.06 4.73
1361 1364 9.142515 CAATTGCAAACAAAAGATATTCTGCTA 57.857 29.630 1.71 0.00 39.77 3.49
1583 1599 6.149308 ACATTTAATGCGTCAATTGAGAGTCA 59.851 34.615 8.80 8.91 0.00 3.41
1592 1608 3.434637 GCCGAACATTTAATGCGTCAAT 58.565 40.909 4.68 0.00 0.00 2.57
1681 1697 0.804364 TGCAGTCTGCCATAAAAGCG 59.196 50.000 21.99 0.00 44.23 4.68
1699 1715 1.945394 GTGATAATCAGTGCAGGCCTG 59.055 52.381 29.34 29.34 0.00 4.85
1704 1720 4.692155 TGACACAAGTGATAATCAGTGCAG 59.308 41.667 7.28 0.00 28.97 4.41
1890 1947 5.609423 ACTTGCATCTTCATACATCTCCTC 58.391 41.667 0.00 0.00 0.00 3.71
1924 1981 3.508402 TCTGATACTACCAACAGCGTCAA 59.492 43.478 0.00 0.00 0.00 3.18
2004 2061 3.304829 TGCCCTGTTTCCTTAAAGCTTT 58.695 40.909 17.30 17.30 0.00 3.51
2040 2097 1.351076 CCAAAACCAAGCCCTCCAAT 58.649 50.000 0.00 0.00 0.00 3.16
2066 2123 7.516627 GCAAATGTCAAATACAACACCAAGAAC 60.517 37.037 0.00 0.00 42.70 3.01
2121 2178 6.035758 GCGAAACTAGATTTTCCTTGACGTAT 59.964 38.462 0.00 0.00 32.67 3.06
2129 2186 5.491982 ACATCTGCGAAACTAGATTTTCCT 58.508 37.500 0.00 0.00 32.67 3.36
2140 2197 6.910433 TCTTACTTTGAAAACATCTGCGAAAC 59.090 34.615 0.00 0.00 0.00 2.78
2254 2414 1.675641 CCTGCGAAACCCCAAGAGG 60.676 63.158 0.00 0.00 0.00 3.69
2328 2488 9.892130 ATTTTTGACTTCCGATCTAGAATACTT 57.108 29.630 0.00 0.00 0.00 2.24
2421 2581 3.592059 GCGTGATGGGTACTTGAAACTA 58.408 45.455 0.00 0.00 0.00 2.24
2502 2662 6.228273 TGAACAAGACTAGAAAAGATTGCG 57.772 37.500 0.00 0.00 32.26 4.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.