Multiple sequence alignment - TraesCS6D01G098700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G098700 chr6D 100.000 2264 0 0 1 2264 62141242 62143505 0.000000e+00 4181
1 TraesCS6D01G098700 chr6D 96.249 1946 61 2 1 1934 377212207 377214152 0.000000e+00 3179
2 TraesCS6D01G098700 chr6D 89.434 265 12 6 2001 2264 377214323 377214572 1.010000e-83 320
3 TraesCS6D01G098700 chr2D 96.425 2042 56 6 1 2029 619853633 619855670 0.000000e+00 3350
4 TraesCS6D01G098700 chr2D 96.667 150 5 0 2115 2264 619855783 619855932 1.340000e-62 250
5 TraesCS6D01G098700 chr4D 96.490 2023 58 3 1 2010 470196636 470194614 0.000000e+00 3330
6 TraesCS6D01G098700 chr4D 92.857 266 16 3 2001 2264 470194473 470194209 1.270000e-102 383
7 TraesCS6D01G098700 chr4D 95.588 204 6 1 2064 2264 122190264 122190467 7.800000e-85 324
8 TraesCS6D01G098700 chr4D 92.424 132 8 1 2001 2132 470194597 470194726 1.070000e-43 187
9 TraesCS6D01G098700 chr3D 95.829 1990 62 5 1 1977 446922426 446924407 0.000000e+00 3195
10 TraesCS6D01G098700 chr7D 95.257 2024 80 7 1 2010 528561189 528563210 0.000000e+00 3192
11 TraesCS6D01G098700 chr7D 95.207 2003 81 9 1 1990 131689396 131691396 0.000000e+00 3153
12 TraesCS6D01G098700 chr7D 88.258 264 24 5 2001 2264 460801934 460802190 2.180000e-80 309
13 TraesCS6D01G098700 chrUn 95.399 1978 77 8 1 1966 10399175 10401150 0.000000e+00 3136
14 TraesCS6D01G098700 chr5D 97.049 1796 40 3 1 1784 348341245 348343039 0.000000e+00 3011
15 TraesCS6D01G098700 chr5D 91.315 829 53 9 1215 2029 445782527 445781704 0.000000e+00 1114
16 TraesCS6D01G098700 chr5D 90.283 247 14 4 2019 2264 348343834 348344071 4.690000e-82 315
17 TraesCS6D01G098700 chr1D 93.782 1978 95 12 1 1965 446419310 446421272 0.000000e+00 2946
18 TraesCS6D01G098700 chr1A 94.860 1712 71 8 337 2035 311772304 311770597 0.000000e+00 2658
19 TraesCS6D01G098700 chr1A 91.288 264 17 4 2001 2264 311770479 311770222 2.770000e-94 355
20 TraesCS6D01G098700 chr3A 93.419 1322 68 9 703 2010 497386626 497387942 0.000000e+00 1941
21 TraesCS6D01G098700 chr3A 88.776 294 29 4 1720 2010 349070483 349070775 7.690000e-95 357
22 TraesCS6D01G098700 chr5A 93.041 1322 61 10 703 2010 690039825 690041129 0.000000e+00 1903
23 TraesCS6D01G098700 chr5A 93.226 871 44 5 1153 2010 599242419 599243287 0.000000e+00 1267
24 TraesCS6D01G098700 chr3B 88.302 265 22 6 2001 2264 21881626 21881882 2.180000e-80 309
25 TraesCS6D01G098700 chr6A 91.000 200 12 6 2066 2264 7032270 7032464 4.790000e-67 265
26 TraesCS6D01G098700 chr4B 91.667 180 12 2 2085 2264 566251138 566250962 1.740000e-61 246


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G098700 chr6D 62141242 62143505 2263 False 4181.0 4181 100.0000 1 2264 1 chr6D.!!$F1 2263
1 TraesCS6D01G098700 chr6D 377212207 377214572 2365 False 1749.5 3179 92.8415 1 2264 2 chr6D.!!$F2 2263
2 TraesCS6D01G098700 chr2D 619853633 619855932 2299 False 1800.0 3350 96.5460 1 2264 2 chr2D.!!$F1 2263
3 TraesCS6D01G098700 chr4D 470194209 470196636 2427 True 1856.5 3330 94.6735 1 2264 2 chr4D.!!$R1 2263
4 TraesCS6D01G098700 chr3D 446922426 446924407 1981 False 3195.0 3195 95.8290 1 1977 1 chr3D.!!$F1 1976
5 TraesCS6D01G098700 chr7D 528561189 528563210 2021 False 3192.0 3192 95.2570 1 2010 1 chr7D.!!$F3 2009
6 TraesCS6D01G098700 chr7D 131689396 131691396 2000 False 3153.0 3153 95.2070 1 1990 1 chr7D.!!$F1 1989
7 TraesCS6D01G098700 chrUn 10399175 10401150 1975 False 3136.0 3136 95.3990 1 1966 1 chrUn.!!$F1 1965
8 TraesCS6D01G098700 chr5D 348341245 348344071 2826 False 1663.0 3011 93.6660 1 2264 2 chr5D.!!$F1 2263
9 TraesCS6D01G098700 chr5D 445781704 445782527 823 True 1114.0 1114 91.3150 1215 2029 1 chr5D.!!$R1 814
10 TraesCS6D01G098700 chr1D 446419310 446421272 1962 False 2946.0 2946 93.7820 1 1965 1 chr1D.!!$F1 1964
11 TraesCS6D01G098700 chr1A 311770222 311772304 2082 True 1506.5 2658 93.0740 337 2264 2 chr1A.!!$R1 1927
12 TraesCS6D01G098700 chr3A 497386626 497387942 1316 False 1941.0 1941 93.4190 703 2010 1 chr3A.!!$F2 1307
13 TraesCS6D01G098700 chr5A 690039825 690041129 1304 False 1903.0 1903 93.0410 703 2010 1 chr5A.!!$F2 1307
14 TraesCS6D01G098700 chr5A 599242419 599243287 868 False 1267.0 1267 93.2260 1153 2010 1 chr5A.!!$F1 857

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
836 838 1.445582 CGGTGGTTCTAGGACACGC 60.446 63.158 2.92 0.0 36.02 5.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2010 2615 0.108329 CTGGCGGTAGGGTACAACAG 60.108 60.0 0.0 0.0 0.0 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
178 179 3.550431 CGATGAGCCGGGTGGGAT 61.550 66.667 12.94 0.00 38.47 3.85
204 205 2.054799 GGGATGGTAGGTCTTATGGCA 58.945 52.381 0.00 0.00 0.00 4.92
251 252 1.600636 CCGTTGGTGCCAGTGTGAT 60.601 57.895 0.00 0.00 0.00 3.06
407 408 3.408634 TCGGTTCAATCCTTTCCTTGAC 58.591 45.455 0.00 0.00 31.41 3.18
836 838 1.445582 CGGTGGTTCTAGGACACGC 60.446 63.158 2.92 0.00 36.02 5.34
1011 1018 1.216064 TGTAGGGCATGGCTTCATCT 58.784 50.000 19.78 9.59 0.00 2.90
1252 1260 3.039011 ACTAACGCCTATGACCTTCCAT 58.961 45.455 0.00 0.00 0.00 3.41
1463 1471 1.594310 GCTTGGAGGAAGAGCGTCT 59.406 57.895 0.00 0.00 32.82 4.18
1637 1646 5.394883 CCCGTATAACTCAGTAAAGCCTTCA 60.395 44.000 0.00 0.00 0.00 3.02
1644 1653 1.464997 CAGTAAAGCCTTCACTTCGGC 59.535 52.381 0.00 0.00 46.65 5.54
2014 2619 3.717294 CCCTGGCGGTAGGCTGTT 61.717 66.667 0.00 0.00 44.18 3.16
2015 2620 2.436646 CCTGGCGGTAGGCTGTTG 60.437 66.667 0.00 0.00 44.18 3.33
2016 2621 2.347490 CTGGCGGTAGGCTGTTGT 59.653 61.111 0.00 0.00 44.18 3.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
178 179 5.368523 CCATAAGACCTACCATCCCTTGTTA 59.631 44.000 0.00 0.00 0.00 2.41
204 205 0.388649 CGCACCTCGTAAGCAACTCT 60.389 55.000 0.00 0.00 37.18 3.24
251 252 3.884895 CCAATGATACTTGTGTGGCCTA 58.115 45.455 3.32 0.00 0.00 3.93
575 576 5.278660 GCATTCTCCACAATTGTTGTTCTCT 60.279 40.000 8.77 0.00 43.23 3.10
805 807 2.517414 CACCGGATCCATGGCCAT 59.483 61.111 14.09 14.09 0.00 4.40
811 813 1.062428 TCCTAGAACCACCGGATCCAT 60.062 52.381 9.46 0.00 0.00 3.41
836 838 1.837090 CCTTCCCCTATCAACCCGG 59.163 63.158 0.00 0.00 0.00 5.73
979 985 6.630188 GCCATGCCCTACAACAAATAAAGATT 60.630 38.462 0.00 0.00 0.00 2.40
1011 1018 2.220586 TGGCCTCGTCATGGAACCA 61.221 57.895 3.32 0.00 0.00 3.67
1195 1203 3.380004 TCGTAAGCATAATTGGGGCAAAG 59.620 43.478 0.00 0.00 37.18 2.77
1252 1260 5.593095 ACATGTTACTTCTCTAGCATACCGA 59.407 40.000 0.00 0.00 0.00 4.69
1463 1471 2.167281 CGCTCCATCCTCTCTTTCTGAA 59.833 50.000 0.00 0.00 0.00 3.02
1620 1629 4.058817 CGAAGTGAAGGCTTTACTGAGTT 58.941 43.478 23.33 9.35 0.00 3.01
1637 1646 2.341101 ATGACGAGTCCGCCGAAGT 61.341 57.895 0.34 0.00 39.95 3.01
1644 1653 0.524816 CCGGTTACATGACGAGTCCG 60.525 60.000 0.00 4.77 42.50 4.79
2010 2615 0.108329 CTGGCGGTAGGGTACAACAG 60.108 60.000 0.00 0.00 0.00 3.16
2012 2617 1.219935 CCTGGCGGTAGGGTACAAC 59.780 63.158 0.00 0.00 34.06 3.32
2013 2618 3.716381 CCTGGCGGTAGGGTACAA 58.284 61.111 0.00 0.00 34.06 2.41
2032 2670 1.719780 CTGTAACGAGAAACGACAGCC 59.280 52.381 0.00 0.00 45.77 4.85
2080 2720 1.400530 GCTGTACCCTACCGCCAGAT 61.401 60.000 0.00 0.00 33.49 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.