Multiple sequence alignment - TraesCS6D01G095900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G095900 chr6D 100.000 2792 0 0 1 2792 60152683 60155474 0.000000e+00 5156
1 TraesCS6D01G095900 chr6D 96.889 2636 51 7 184 2791 418034286 418036918 0.000000e+00 4385
2 TraesCS6D01G095900 chr6D 96.703 2639 51 11 184 2792 449233716 449236348 0.000000e+00 4359
3 TraesCS6D01G095900 chr6D 99.457 184 1 0 1 184 418034072 418034255 4.460000e-88 335
4 TraesCS6D01G095900 chr6D 98.370 184 3 0 1 184 449233502 449233685 9.650000e-85 324
5 TraesCS6D01G095900 chr6D 99.429 175 1 0 1 175 60143473 60143647 4.490000e-83 318
6 TraesCS6D01G095900 chr7D 96.787 2832 43 6 1 2792 590354608 590357431 0.000000e+00 4682
7 TraesCS6D01G095900 chr7D 97.019 2617 59 15 184 2792 403425320 403427925 0.000000e+00 4383
8 TraesCS6D01G095900 chr7D 96.359 2637 58 12 184 2792 440163951 440166577 0.000000e+00 4303
9 TraesCS6D01G095900 chr7D 97.838 185 3 1 1 184 403425105 403425289 4.490000e-83 318
10 TraesCS6D01G095900 chr7D 97.826 184 4 0 1 184 440163737 440163920 4.490000e-83 318
11 TraesCS6D01G095900 chr1D 96.437 2638 57 13 184 2792 155922889 155920260 0.000000e+00 4316
12 TraesCS6D01G095900 chr1D 93.548 589 25 10 184 766 33806486 33807067 0.000000e+00 865
13 TraesCS6D01G095900 chr5D 95.965 2404 54 16 184 2558 473036147 473033758 0.000000e+00 3862
14 TraesCS6D01G095900 chr5D 98.370 184 3 0 1 184 473036361 473036178 9.650000e-85 324
15 TraesCS6D01G095900 chr2D 97.343 2032 47 6 761 2792 14275576 14277600 0.000000e+00 3446
16 TraesCS6D01G095900 chr2D 96.688 2053 40 7 762 2792 43330494 43328448 0.000000e+00 3389
17 TraesCS6D01G095900 chr2D 93.403 1243 72 7 1552 2792 542547946 542549180 0.000000e+00 1832
18 TraesCS6D01G095900 chr2D 97.826 184 4 0 1 184 14274977 14275160 4.490000e-83 318
19 TraesCS6D01G095900 chr2D 97.283 184 4 1 1 184 43331096 43330914 7.510000e-81 311
20 TraesCS6D01G095900 chr1A 94.589 2033 93 10 761 2792 61160759 61162775 0.000000e+00 3129
21 TraesCS6D01G095900 chr4D 93.367 588 26 10 184 766 32721787 32721208 0.000000e+00 857


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G095900 chr6D 60152683 60155474 2791 False 5156.0 5156 100.0000 1 2792 1 chr6D.!!$F2 2791
1 TraesCS6D01G095900 chr6D 418034072 418036918 2846 False 2360.0 4385 98.1730 1 2791 2 chr6D.!!$F3 2790
2 TraesCS6D01G095900 chr6D 449233502 449236348 2846 False 2341.5 4359 97.5365 1 2792 2 chr6D.!!$F4 2791
3 TraesCS6D01G095900 chr7D 590354608 590357431 2823 False 4682.0 4682 96.7870 1 2792 1 chr7D.!!$F1 2791
4 TraesCS6D01G095900 chr7D 403425105 403427925 2820 False 2350.5 4383 97.4285 1 2792 2 chr7D.!!$F2 2791
5 TraesCS6D01G095900 chr7D 440163737 440166577 2840 False 2310.5 4303 97.0925 1 2792 2 chr7D.!!$F3 2791
6 TraesCS6D01G095900 chr1D 155920260 155922889 2629 True 4316.0 4316 96.4370 184 2792 1 chr1D.!!$R1 2608
7 TraesCS6D01G095900 chr1D 33806486 33807067 581 False 865.0 865 93.5480 184 766 1 chr1D.!!$F1 582
8 TraesCS6D01G095900 chr5D 473033758 473036361 2603 True 2093.0 3862 97.1675 1 2558 2 chr5D.!!$R1 2557
9 TraesCS6D01G095900 chr2D 14274977 14277600 2623 False 1882.0 3446 97.5845 1 2792 2 chr2D.!!$F2 2791
10 TraesCS6D01G095900 chr2D 43328448 43331096 2648 True 1850.0 3389 96.9855 1 2792 2 chr2D.!!$R1 2791
11 TraesCS6D01G095900 chr2D 542547946 542549180 1234 False 1832.0 1832 93.4030 1552 2792 1 chr2D.!!$F1 1240
12 TraesCS6D01G095900 chr1A 61160759 61162775 2016 False 3129.0 3129 94.5890 761 2792 1 chr1A.!!$F1 2031
13 TraesCS6D01G095900 chr4D 32721208 32721787 579 True 857.0 857 93.3670 184 766 1 chr4D.!!$R1 582

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
467 523 1.066787 GCTCCTGGTAAGCTCTTCGTT 60.067 52.381 0.37 0.0 36.80 3.85 F
715 777 5.920273 CCCAAACAAGTGTTTATAGTTGCTG 59.080 40.000 9.01 0.0 45.54 4.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1302 1367 2.093658 GTGTTCCCTCGCATCCTCTAAA 60.094 50.0 0.00 0.0 0.00 1.85 R
2478 2641 0.676782 AAGCCTCCGCGTATGCTTTT 60.677 50.0 17.14 1.0 40.98 2.27 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
408 457 2.852449 ACATTCCATATGGTCCCACTGT 59.148 45.455 21.28 9.59 36.34 3.55
467 523 1.066787 GCTCCTGGTAAGCTCTTCGTT 60.067 52.381 0.37 0.00 36.80 3.85
520 576 6.258230 TCATCAAAAGTTGTAATCTGCTGG 57.742 37.500 0.00 0.00 0.00 4.85
522 578 6.939730 TCATCAAAAGTTGTAATCTGCTGGTA 59.060 34.615 0.00 0.00 0.00 3.25
715 777 5.920273 CCCAAACAAGTGTTTATAGTTGCTG 59.080 40.000 9.01 0.00 45.54 4.41
1302 1367 3.121030 GGCATGCGCTTCGACACT 61.121 61.111 12.44 0.00 38.60 3.55
1761 1827 4.757149 ACTCACCTAAATGACTGCAACTTC 59.243 41.667 0.00 0.00 0.00 3.01
2065 2217 2.844946 TCATTTTCCGTGCAACTCTGA 58.155 42.857 0.00 0.00 31.75 3.27
2066 2218 3.210227 TCATTTTCCGTGCAACTCTGAA 58.790 40.909 0.00 0.00 31.75 3.02
2067 2219 3.629855 TCATTTTCCGTGCAACTCTGAAA 59.370 39.130 0.00 0.00 31.75 2.69
2068 2220 4.097135 TCATTTTCCGTGCAACTCTGAAAA 59.903 37.500 7.31 7.31 39.22 2.29
2069 2221 4.647424 TTTTCCGTGCAACTCTGAAAAT 57.353 36.364 0.00 0.00 34.15 1.82
2070 2222 5.759506 TTTTCCGTGCAACTCTGAAAATA 57.240 34.783 0.00 0.00 34.15 1.40
2071 2223 5.759506 TTTCCGTGCAACTCTGAAAATAA 57.240 34.783 0.00 0.00 31.75 1.40
2202 2362 1.394917 CTCGCTGCATTGTGGTTAGTC 59.605 52.381 0.00 0.00 0.00 2.59
2509 2672 2.497138 CGGAGGCTTATCATGATTGCA 58.503 47.619 24.78 4.50 0.00 4.08
2765 2928 1.545582 CCTGGCAACGATTCACCATTT 59.454 47.619 0.00 0.00 42.51 2.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
364 413 4.833390 AGCAAAGTATCTTAGTGTGGGAC 58.167 43.478 0.00 0.0 0.00 4.46
467 523 7.701539 AAGAAACAACCAATGTGCATATCTA 57.298 32.000 0.00 0.0 42.99 1.98
1302 1367 2.093658 GTGTTCCCTCGCATCCTCTAAA 60.094 50.000 0.00 0.0 0.00 1.85
1761 1827 2.942376 TGTGAGTTTTGTACCTGCTGTG 59.058 45.455 0.00 0.0 0.00 3.66
2071 2223 9.844257 TTTTGATGGGTGATGTCTTTTATTTTT 57.156 25.926 0.00 0.0 0.00 1.94
2478 2641 0.676782 AAGCCTCCGCGTATGCTTTT 60.677 50.000 17.14 1.0 40.98 2.27
2509 2672 5.711506 TGAGGTAAGTTGCATCAAATGACAT 59.288 36.000 5.82 0.0 25.69 3.06


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.