Multiple sequence alignment - TraesCS6D01G087100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G087100 chr6D 100.000 2547 0 0 1 2547 52522315 52519769 0.000000e+00 4704
1 TraesCS6D01G087100 chr6D 96.948 1966 48 6 589 2547 109963231 109965191 0.000000e+00 3288
2 TraesCS6D01G087100 chr6D 97.418 581 13 2 1 580 52581664 52582243 0.000000e+00 989
3 TraesCS6D01G087100 chr6D 93.103 522 28 3 66 579 109391051 109391572 0.000000e+00 758
4 TraesCS6D01G087100 chr6D 92.593 81 6 0 1 81 37916971 37917051 1.600000e-22 117
5 TraesCS6D01G087100 chr5D 96.999 1966 47 7 589 2547 336262643 336264603 0.000000e+00 3293
6 TraesCS6D01G087100 chr5D 93.103 522 28 3 66 579 125597840 125598361 0.000000e+00 758
7 TraesCS6D01G087100 chr5D 91.765 85 6 1 1 84 461280605 461280521 1.600000e-22 117
8 TraesCS6D01G087100 chr1D 96.690 1964 56 5 589 2547 26486157 26488116 0.000000e+00 3258
9 TraesCS6D01G087100 chr1D 92.529 522 31 3 66 579 68528969 68529490 0.000000e+00 741
10 TraesCS6D01G087100 chr1D 92.529 522 31 4 66 579 428921414 428920893 0.000000e+00 741
11 TraesCS6D01G087100 chr1D 93.827 81 3 2 1 80 217791045 217791124 1.240000e-23 121
12 TraesCS6D01G087100 chr7D 96.383 1963 61 6 589 2547 574727099 574725143 0.000000e+00 3223
13 TraesCS6D01G087100 chr7D 97.297 74 2 0 1 74 124981250 124981323 2.660000e-25 126
14 TraesCS6D01G087100 chr7D 93.827 81 4 1 1 80 422400688 422400608 1.240000e-23 121
15 TraesCS6D01G087100 chr2D 96.089 1969 62 8 589 2547 238958905 238960868 0.000000e+00 3195
16 TraesCS6D01G087100 chr2D 95.183 1972 76 11 589 2547 331197198 331199163 0.000000e+00 3097
17 TraesCS6D01G087100 chr2D 93.204 515 32 2 66 579 328753902 328753390 0.000000e+00 754
18 TraesCS6D01G087100 chr2D 94.253 87 1 4 1 86 234310682 234310599 2.060000e-26 130
19 TraesCS6D01G087100 chrUn 95.294 1976 71 14 589 2547 93726491 93724521 0.000000e+00 3114
20 TraesCS6D01G087100 chr7A 95.231 1971 77 10 589 2547 701581960 701583925 0.000000e+00 3103
21 TraesCS6D01G087100 chr6B 95.129 1971 77 11 589 2547 660437724 660435761 0.000000e+00 3090
22 TraesCS6D01G087100 chr3D 92.720 522 30 3 66 579 600677536 600678057 0.000000e+00 747
23 TraesCS6D01G087100 chr3D 92.529 522 31 3 66 579 98066517 98067038 0.000000e+00 741
24 TraesCS6D01G087100 chr3D 92.857 84 3 3 1 82 585584575 585584657 4.450000e-23 119
25 TraesCS6D01G087100 chr4D 92.706 521 30 3 66 578 229326611 229326091 0.000000e+00 745
26 TraesCS6D01G087100 chr4D 100.000 69 0 0 1 69 244358570 244358638 7.400000e-26 128


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G087100 chr6D 52519769 52522315 2546 True 4704 4704 100.000 1 2547 1 chr6D.!!$R1 2546
1 TraesCS6D01G087100 chr6D 109963231 109965191 1960 False 3288 3288 96.948 589 2547 1 chr6D.!!$F4 1958
2 TraesCS6D01G087100 chr6D 52581664 52582243 579 False 989 989 97.418 1 580 1 chr6D.!!$F2 579
3 TraesCS6D01G087100 chr6D 109391051 109391572 521 False 758 758 93.103 66 579 1 chr6D.!!$F3 513
4 TraesCS6D01G087100 chr5D 336262643 336264603 1960 False 3293 3293 96.999 589 2547 1 chr5D.!!$F2 1958
5 TraesCS6D01G087100 chr5D 125597840 125598361 521 False 758 758 93.103 66 579 1 chr5D.!!$F1 513
6 TraesCS6D01G087100 chr1D 26486157 26488116 1959 False 3258 3258 96.690 589 2547 1 chr1D.!!$F1 1958
7 TraesCS6D01G087100 chr1D 68528969 68529490 521 False 741 741 92.529 66 579 1 chr1D.!!$F2 513
8 TraesCS6D01G087100 chr1D 428920893 428921414 521 True 741 741 92.529 66 579 1 chr1D.!!$R1 513
9 TraesCS6D01G087100 chr7D 574725143 574727099 1956 True 3223 3223 96.383 589 2547 1 chr7D.!!$R2 1958
10 TraesCS6D01G087100 chr2D 238958905 238960868 1963 False 3195 3195 96.089 589 2547 1 chr2D.!!$F1 1958
11 TraesCS6D01G087100 chr2D 331197198 331199163 1965 False 3097 3097 95.183 589 2547 1 chr2D.!!$F2 1958
12 TraesCS6D01G087100 chr2D 328753390 328753902 512 True 754 754 93.204 66 579 1 chr2D.!!$R2 513
13 TraesCS6D01G087100 chrUn 93724521 93726491 1970 True 3114 3114 95.294 589 2547 1 chrUn.!!$R1 1958
14 TraesCS6D01G087100 chr7A 701581960 701583925 1965 False 3103 3103 95.231 589 2547 1 chr7A.!!$F1 1958
15 TraesCS6D01G087100 chr6B 660435761 660437724 1963 True 3090 3090 95.129 589 2547 1 chr6B.!!$R1 1958
16 TraesCS6D01G087100 chr3D 600677536 600678057 521 False 747 747 92.720 66 579 1 chr3D.!!$F3 513
17 TraesCS6D01G087100 chr3D 98066517 98067038 521 False 741 741 92.529 66 579 1 chr3D.!!$F1 513
18 TraesCS6D01G087100 chr4D 229326091 229326611 520 True 745 745 92.706 66 578 1 chr4D.!!$R1 512

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
584 602 0.172578 CATACTCGACCGCCACTCAA 59.827 55.0 0.0 0.0 0.0 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1747 1787 0.398381 TTTGGCCCAAGAGCAACCTT 60.398 50.0 0.0 0.0 0.0 3.5 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
504 522 1.867166 GCCGGATTTAGTGGCTCTAC 58.133 55.000 5.05 0.0 45.40 2.59
515 533 0.251209 TGGCTCTACGTCCAGTCAGT 60.251 55.000 0.00 0.0 0.00 3.41
534 552 2.496899 TGGAAGGAGCCACTCAAATC 57.503 50.000 0.00 0.0 31.66 2.17
579 597 4.201679 CCGCATACTCGACCGCCA 62.202 66.667 0.00 0.0 0.00 5.69
580 598 2.954868 CGCATACTCGACCGCCAC 60.955 66.667 0.00 0.0 0.00 5.01
581 599 2.494918 GCATACTCGACCGCCACT 59.505 61.111 0.00 0.0 0.00 4.00
582 600 1.589196 GCATACTCGACCGCCACTC 60.589 63.158 0.00 0.0 0.00 3.51
583 601 1.807226 CATACTCGACCGCCACTCA 59.193 57.895 0.00 0.0 0.00 3.41
584 602 0.172578 CATACTCGACCGCCACTCAA 59.827 55.000 0.00 0.0 0.00 3.02
585 603 0.892755 ATACTCGACCGCCACTCAAA 59.107 50.000 0.00 0.0 0.00 2.69
586 604 0.675083 TACTCGACCGCCACTCAAAA 59.325 50.000 0.00 0.0 0.00 2.44
587 605 0.179067 ACTCGACCGCCACTCAAAAA 60.179 50.000 0.00 0.0 0.00 1.94
638 656 1.741706 CCTCAGATGCGAATTGTGCTT 59.258 47.619 0.00 0.0 0.00 3.91
693 711 1.666011 GTGAACTCAGCCGTCTCCA 59.334 57.895 0.00 0.0 0.00 3.86
732 750 3.821886 GCCCTTACAGGTGGGACT 58.178 61.111 1.75 0.0 46.15 3.85
812 830 1.153667 GAGAGCCGTTGAGCAGAGG 60.154 63.158 0.00 0.0 34.23 3.69
1173 1207 2.933139 AGAATGGGGTAAGAATTGGGGT 59.067 45.455 0.00 0.0 0.00 4.95
1441 1475 6.887002 GGATGTTGAAGAAGAAGGTTAGGAAT 59.113 38.462 0.00 0.0 0.00 3.01
1508 1542 5.103898 TGGGCATTTGTAGGTATGGTAATCA 60.104 40.000 0.00 0.0 0.00 2.57
1522 1556 7.988599 GGTATGGTAATCACACTGGTTGTAATA 59.011 37.037 0.00 0.0 35.67 0.98
2036 2080 3.159213 TGTCATGGAAAATGTGCCTCT 57.841 42.857 0.00 0.0 0.00 3.69
2219 2269 4.715523 GGGCTGCGCTGGTAACCA 62.716 66.667 16.47 0.0 0.00 3.67
2272 2322 5.720520 GGTAGGGAAGGAAGGTATACATAGG 59.279 48.000 5.01 0.0 0.00 2.57
2350 2406 4.842574 AGTGGTTTTCCTTTGTTTTGCAT 58.157 34.783 0.00 0.0 41.38 3.96
2460 2516 7.690256 AGAGTGACACTTGGTTTAGGATTTAT 58.310 34.615 10.01 0.0 0.00 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
42 43 4.566837 TGAAGGAAATATGCCCTAGAGGA 58.433 43.478 0.00 0.0 38.24 3.71
43 44 4.263243 CCTGAAGGAAATATGCCCTAGAGG 60.263 50.000 0.00 0.0 37.39 3.69
126 127 5.061684 TGTTATGTGACTTAAATCGTCAGCG 59.938 40.000 0.00 0.0 41.62 5.18
321 329 1.578926 CGCAAAAGCGGGTCATGAA 59.421 52.632 0.00 0.0 0.00 2.57
515 533 1.004745 GGATTTGAGTGGCTCCTTCCA 59.995 52.381 0.00 0.0 0.00 3.53
579 597 4.163458 TGGACACTACTGAGGTTTTTGAGT 59.837 41.667 0.00 0.0 0.00 3.41
580 598 4.703897 TGGACACTACTGAGGTTTTTGAG 58.296 43.478 0.00 0.0 0.00 3.02
581 599 4.764050 TGGACACTACTGAGGTTTTTGA 57.236 40.909 0.00 0.0 0.00 2.69
582 600 4.821805 ACATGGACACTACTGAGGTTTTTG 59.178 41.667 0.00 0.0 0.00 2.44
583 601 4.821805 CACATGGACACTACTGAGGTTTTT 59.178 41.667 0.00 0.0 0.00 1.94
584 602 4.389374 CACATGGACACTACTGAGGTTTT 58.611 43.478 0.00 0.0 0.00 2.43
585 603 3.807209 GCACATGGACACTACTGAGGTTT 60.807 47.826 0.00 0.0 0.00 3.27
586 604 2.289694 GCACATGGACACTACTGAGGTT 60.290 50.000 0.00 0.0 0.00 3.50
587 605 1.276421 GCACATGGACACTACTGAGGT 59.724 52.381 0.00 0.0 0.00 3.85
638 656 1.829222 CTCGGACTAGGGGCAAAACTA 59.171 52.381 0.00 0.0 0.00 2.24
812 830 5.915236 TATATAGCACACCTGCAACGGCC 62.915 52.174 0.00 0.0 46.97 6.13
1349 1383 0.608308 TCTTCTTCCGGAGCTCGTGA 60.608 55.000 3.34 3.5 37.11 4.35
1522 1556 7.185318 TCATGCCTTTCCATACATTTTCAAT 57.815 32.000 0.00 0.0 0.00 2.57
1747 1787 0.398381 TTTGGCCCAAGAGCAACCTT 60.398 50.000 0.00 0.0 0.00 3.50
1895 1936 7.491048 TCAATTAGCTTCCACAAAAAGTTTCAC 59.509 33.333 0.00 0.0 0.00 3.18
2036 2080 2.565834 GGTGTAAACCTCTACCAGAGCA 59.434 50.000 0.00 0.0 40.98 4.26
2219 2269 2.826488 AGTCTTGCCATCTGTCCTAGT 58.174 47.619 0.00 0.0 0.00 2.57
2350 2406 4.102367 CCTTCCAACCCTCCAAAATTTCAA 59.898 41.667 0.00 0.0 0.00 2.69
2460 2516 9.249053 TGAACTAACATGCAAATTTATTCCCTA 57.751 29.630 0.00 0.0 0.00 3.53


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.