Multiple sequence alignment - TraesCS6D01G079900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G079900 chr6D 100.000 2684 0 0 1 2684 45516348 45519031 0.000000e+00 4957.0
1 TraesCS6D01G079900 chr1D 97.878 2686 50 6 1 2684 254401333 254398653 0.000000e+00 4638.0
2 TraesCS6D01G079900 chr1D 97.036 1046 28 3 1 1044 51882839 51883883 0.000000e+00 1757.0
3 TraesCS6D01G079900 chr5D 97.765 2685 51 5 1 2684 6185721 6188397 0.000000e+00 4617.0
4 TraesCS6D01G079900 chr5D 98.070 2435 41 5 251 2684 503281198 503278769 0.000000e+00 4231.0
5 TraesCS6D01G079900 chr5D 97.611 1842 37 6 844 2684 432405875 432404040 0.000000e+00 3151.0
6 TraesCS6D01G079900 chr2A 97.171 2686 49 8 1 2684 335835425 335838085 0.000000e+00 4514.0
7 TraesCS6D01G079900 chr4B 96.201 2685 84 7 1 2683 308693259 308695927 0.000000e+00 4377.0
8 TraesCS6D01G079900 chr4A 95.955 2695 92 12 1 2684 309511900 309514588 0.000000e+00 4357.0
9 TraesCS6D01G079900 chr4A 95.353 2690 107 12 1 2684 310735359 310738036 0.000000e+00 4259.0
10 TraesCS6D01G079900 chr3D 98.021 2122 33 8 565 2684 589282199 589280085 0.000000e+00 3677.0
11 TraesCS6D01G079900 chr5A 96.392 1968 62 8 720 2684 607271896 607273857 0.000000e+00 3232.0
12 TraesCS6D01G079900 chr7A 93.492 1260 68 7 51 1308 91617668 91618915 0.000000e+00 1860.0
13 TraesCS6D01G079900 chr7A 98.030 203 4 0 185 387 91360151 91360353 1.180000e-93 353.0
14 TraesCS6D01G079900 chr7A 98.182 55 1 0 366 420 556770217 556770163 2.200000e-16 97.1
15 TraesCS6D01G079900 chr7A 97.872 47 1 0 514 560 184946132 184946086 6.160000e-12 82.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G079900 chr6D 45516348 45519031 2683 False 4957 4957 100.000 1 2684 1 chr6D.!!$F1 2683
1 TraesCS6D01G079900 chr1D 254398653 254401333 2680 True 4638 4638 97.878 1 2684 1 chr1D.!!$R1 2683
2 TraesCS6D01G079900 chr1D 51882839 51883883 1044 False 1757 1757 97.036 1 1044 1 chr1D.!!$F1 1043
3 TraesCS6D01G079900 chr5D 6185721 6188397 2676 False 4617 4617 97.765 1 2684 1 chr5D.!!$F1 2683
4 TraesCS6D01G079900 chr5D 503278769 503281198 2429 True 4231 4231 98.070 251 2684 1 chr5D.!!$R2 2433
5 TraesCS6D01G079900 chr5D 432404040 432405875 1835 True 3151 3151 97.611 844 2684 1 chr5D.!!$R1 1840
6 TraesCS6D01G079900 chr2A 335835425 335838085 2660 False 4514 4514 97.171 1 2684 1 chr2A.!!$F1 2683
7 TraesCS6D01G079900 chr4B 308693259 308695927 2668 False 4377 4377 96.201 1 2683 1 chr4B.!!$F1 2682
8 TraesCS6D01G079900 chr4A 309511900 309514588 2688 False 4357 4357 95.955 1 2684 1 chr4A.!!$F1 2683
9 TraesCS6D01G079900 chr4A 310735359 310738036 2677 False 4259 4259 95.353 1 2684 1 chr4A.!!$F2 2683
10 TraesCS6D01G079900 chr3D 589280085 589282199 2114 True 3677 3677 98.021 565 2684 1 chr3D.!!$R1 2119
11 TraesCS6D01G079900 chr5A 607271896 607273857 1961 False 3232 3232 96.392 720 2684 1 chr5A.!!$F1 1964
12 TraesCS6D01G079900 chr7A 91617668 91618915 1247 False 1860 1860 93.492 51 1308 1 chr7A.!!$F2 1257

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
87 89 3.618752 CGTATCAATGACCTGGTCAACCA 60.619 47.826 31.37 18.32 45.96 3.67 F
1056 1064 0.323302 TGCGTCCTTGGATTGCTGTA 59.677 50.000 14.72 0.00 0.00 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1626 1641 1.819288 TCTAGAGGGAAGTTGTGAGCG 59.181 52.381 0.0 0.0 0.0 5.03 R
2254 2288 2.024655 ACAATCCACTGCCTTGATCCAT 60.025 45.455 0.0 0.0 0.0 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
87 89 3.618752 CGTATCAATGACCTGGTCAACCA 60.619 47.826 31.37 18.32 45.96 3.67
131 133 9.743581 ACGAAATTAAGAAATAGGAAAGGGTTA 57.256 29.630 0.00 0.00 0.00 2.85
615 621 6.705825 GTCCTTGCAATTTGAATAAACCAAGT 59.294 34.615 0.00 0.00 33.00 3.16
622 628 9.255304 GCAATTTGAATAAACCAAGTTCTTACA 57.745 29.630 0.00 0.00 0.00 2.41
646 652 4.883083 TGACTGCAATTTTAGAGAGACGT 58.117 39.130 0.00 0.00 0.00 4.34
976 983 7.934120 GGTCCTTATGAGCTAATTGTTCTACAT 59.066 37.037 0.00 0.00 38.47 2.29
1056 1064 0.323302 TGCGTCCTTGGATTGCTGTA 59.677 50.000 14.72 0.00 0.00 2.74
1347 1356 6.074648 TGAGGGTTACAAATTTGGTCAAGAT 58.925 36.000 21.74 2.02 0.00 2.40
1626 1641 3.429543 TGGAAGTAATGCACGAACGTAAC 59.570 43.478 0.00 0.00 0.00 2.50
1657 1672 4.079672 ACTTCCCTCTAGACTTAGCTGCTA 60.080 45.833 5.02 5.02 0.00 3.49
2118 2150 2.499289 CCTGTCACAGCTGATTACTCCT 59.501 50.000 23.35 0.00 0.00 3.69
2119 2151 3.055530 CCTGTCACAGCTGATTACTCCTT 60.056 47.826 23.35 0.00 0.00 3.36
2315 2349 4.807039 ATTCCCGTCGTTCGCCCG 62.807 66.667 0.00 0.00 38.35 6.13
2587 2626 1.807814 AGATCCGGCTCTACCCAAAT 58.192 50.000 5.89 0.00 33.26 2.32
2626 2665 2.370849 ACATTACCCACTTGTCCGACTT 59.629 45.455 0.00 0.00 0.00 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
36 38 8.458573 AATATCCAAATACCAAATACGCTCAA 57.541 30.769 0.00 0.00 0.00 3.02
615 621 9.283768 TCTCTAAAATTGCAGTCATTGTAAGAA 57.716 29.630 0.00 0.00 34.79 2.52
622 628 5.934625 ACGTCTCTCTAAAATTGCAGTCATT 59.065 36.000 0.00 0.00 0.00 2.57
646 652 1.202879 CCCCACAGGCTTGTACTTTCA 60.203 52.381 0.00 0.00 35.25 2.69
1056 1064 2.236766 GCAATGGGAGCTGAATATGCT 58.763 47.619 0.00 0.00 44.24 3.79
1347 1356 8.405531 GCAGCCACAATATTATAAGTTTCTTCA 58.594 33.333 0.00 0.00 0.00 3.02
1535 1544 4.491676 GCGACCTTGACTATCAACTACAA 58.508 43.478 0.00 0.00 32.21 2.41
1626 1641 1.819288 TCTAGAGGGAAGTTGTGAGCG 59.181 52.381 0.00 0.00 0.00 5.03
1805 1821 9.742552 GTCGTTAACTGAATTCTGAATAGAAAC 57.257 33.333 18.13 9.73 45.47 2.78
2098 2130 3.883830 AGGAGTAATCAGCTGTGACAG 57.116 47.619 14.67 8.52 34.75 3.51
2254 2288 2.024655 ACAATCCACTGCCTTGATCCAT 60.025 45.455 0.00 0.00 0.00 3.41
2359 2393 4.204370 GTCGCCGTAAGTAAATACGTAACC 59.796 45.833 0.00 0.00 45.43 2.85
2626 2665 5.076873 AGTATCCCAAAACTGCTTAGCAAA 58.923 37.500 8.68 0.00 38.41 3.68


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.