Multiple sequence alignment - TraesCS6D01G079800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G079800 chr6D 100.000 2615 0 0 1 2615 45513911 45516525 0.000000e+00 4830
1 TraesCS6D01G079800 chr5D 98.168 2620 40 8 1 2615 503284958 503282342 0.000000e+00 4566
2 TraesCS6D01G079800 chr5D 97.671 2619 49 8 1 2615 6183288 6185898 0.000000e+00 4488
3 TraesCS6D01G079800 chr5D 98.622 2467 28 5 154 2615 483806079 483808544 0.000000e+00 4362
4 TraesCS6D01G079800 chr1D 97.375 2629 42 13 1 2615 254403771 254401156 0.000000e+00 4447
5 TraesCS6D01G079800 chr1D 97.058 2617 61 13 1 2615 51880415 51883017 0.000000e+00 4392
6 TraesCS6D01G079800 chr2A 97.528 2589 55 8 31 2615 335833019 335835602 0.000000e+00 4418
7 TraesCS6D01G079800 chr4A 96.105 2619 81 15 1 2615 310732935 310735536 0.000000e+00 4252
8 TraesCS6D01G079800 chr3D 98.213 2127 23 7 494 2615 598875970 598873854 0.000000e+00 3703
9 TraesCS6D01G079800 chr5A 96.876 2113 47 13 30 2134 607202453 607204554 0.000000e+00 3518
10 TraesCS6D01G079800 chr5A 96.289 485 18 0 2131 2615 607216288 607216772 0.000000e+00 797
11 TraesCS6D01G079800 chr7A 95.641 390 10 7 16 404 110407225 110406842 1.030000e-173 619


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G079800 chr6D 45513911 45516525 2614 False 4830 4830 100.000 1 2615 1 chr6D.!!$F1 2614
1 TraesCS6D01G079800 chr5D 503282342 503284958 2616 True 4566 4566 98.168 1 2615 1 chr5D.!!$R1 2614
2 TraesCS6D01G079800 chr5D 6183288 6185898 2610 False 4488 4488 97.671 1 2615 1 chr5D.!!$F1 2614
3 TraesCS6D01G079800 chr5D 483806079 483808544 2465 False 4362 4362 98.622 154 2615 1 chr5D.!!$F2 2461
4 TraesCS6D01G079800 chr1D 254401156 254403771 2615 True 4447 4447 97.375 1 2615 1 chr1D.!!$R1 2614
5 TraesCS6D01G079800 chr1D 51880415 51883017 2602 False 4392 4392 97.058 1 2615 1 chr1D.!!$F1 2614
6 TraesCS6D01G079800 chr2A 335833019 335835602 2583 False 4418 4418 97.528 31 2615 1 chr2A.!!$F1 2584
7 TraesCS6D01G079800 chr4A 310732935 310735536 2601 False 4252 4252 96.105 1 2615 1 chr4A.!!$F1 2614
8 TraesCS6D01G079800 chr3D 598873854 598875970 2116 True 3703 3703 98.213 494 2615 1 chr3D.!!$R1 2121
9 TraesCS6D01G079800 chr5A 607202453 607204554 2101 False 3518 3518 96.876 30 2134 1 chr5A.!!$F1 2104

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
632 647 0.391228 CGGGGAAAGGTTGGGTTTTG 59.609 55.0 0.0 0.0 0.0 2.44 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1946 1973 0.179124 GATTCTTCGCGGCTGAGTCT 60.179 55.0 6.13 0.0 0.0 3.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
632 647 0.391228 CGGGGAAAGGTTGGGTTTTG 59.609 55.000 0.00 0.00 0.00 2.44
965 985 7.084486 TGTATCATCATTCGATAAACCGAGAG 58.916 38.462 0.00 0.00 39.90 3.20
1829 1855 5.482908 CCTATGGTTCTTTATGGATCCTCG 58.517 45.833 14.23 0.00 0.00 4.63
2110 2138 8.980481 AATGAAAAATTCGATACCATAGTCCT 57.020 30.769 0.00 0.00 0.00 3.85
2122 2150 2.156098 CATAGTCCTCGCTACTCTCCC 58.844 57.143 0.00 0.00 0.00 4.30
2524 2554 3.618752 CGTATCAATGACCTGGTCAACCA 60.619 47.826 31.37 18.32 45.96 3.67
2568 2598 9.743581 ACGAAATTAAGAAATAGGAAAGGGTTA 57.256 29.630 0.00 0.00 0.00 2.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
183 195 7.750229 TGAACTAGCAAGACATCAAAAGATT 57.250 32.000 0.00 0.00 0.00 2.40
632 647 6.775594 AAAAATAAAGGGTCCACTCATAGC 57.224 37.500 0.00 0.00 0.00 2.97
965 985 6.108015 ACTTGAATCAGAGAGAAGAAGCATC 58.892 40.000 0.00 0.00 0.00 3.91
1234 1255 9.706691 GTAATCCAATAATCGATCTTGGTTAGA 57.293 33.333 26.59 15.42 40.28 2.10
1686 1712 5.613358 AGCAAGAAGATTGTTTACGAAGG 57.387 39.130 0.00 0.00 0.00 3.46
1829 1855 8.479313 TCCTTGATATCGAACATAATGCATAC 57.521 34.615 0.00 0.00 0.00 2.39
1889 1916 6.248433 AGGTAGCATTTCCATTTCTTCTTCA 58.752 36.000 0.00 0.00 0.00 3.02
1946 1973 0.179124 GATTCTTCGCGGCTGAGTCT 60.179 55.000 6.13 0.00 0.00 3.24
2110 2138 1.146452 TCCTATGGGGAGAGTAGCGA 58.854 55.000 0.00 0.00 39.58 4.93
2143 2171 4.207165 CCCCGATCCAGTACAAAATTGAT 58.793 43.478 0.00 0.00 0.00 2.57
2473 2503 8.458573 AATATCCAAATACCAAATACGCTCAA 57.541 30.769 0.00 0.00 0.00 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.