Multiple sequence alignment - TraesCS6D01G079600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G079600 chr6D 100.000 2111 0 0 1 2111 45511823 45509713 0.000000e+00 3899
1 TraesCS6D01G079600 chr5D 97.836 2126 29 12 1 2111 503287048 503289171 0.000000e+00 3655
2 TraesCS6D01G079600 chr5D 97.452 2119 29 14 1 2108 6181198 6179094 0.000000e+00 3591
3 TraesCS6D01G079600 chr5D 97.025 2118 36 17 1 2108 120799620 120801720 0.000000e+00 3537
4 TraesCS6D01G079600 chr5D 96.174 2117 59 17 1 2111 167071682 167073782 0.000000e+00 3441
5 TraesCS6D01G079600 chr5D 98.367 1531 13 7 506 2025 512409297 512407768 0.000000e+00 2678
6 TraesCS6D01G079600 chr5D 98.272 1447 12 7 506 1939 512416234 512414788 0.000000e+00 2521
7 TraesCS6D01G079600 chr5D 93.762 1010 34 7 1 1009 513639950 513638969 0.000000e+00 1489
8 TraesCS6D01G079600 chr1D 97.640 2119 23 14 1 2109 254416813 254418914 0.000000e+00 3611
9 TraesCS6D01G079600 chr1D 97.264 2120 42 12 1 2111 51878325 51876213 0.000000e+00 3579
10 TraesCS6D01G079600 chr1D 95.825 1557 54 8 1 1552 260891855 260893405 0.000000e+00 2505
11 TraesCS6D01G079600 chr1A 97.274 2128 26 16 1 2111 554458215 554460327 0.000000e+00 3579
12 TraesCS6D01G079600 chr4A 95.324 2117 63 17 2 2108 309507385 309505295 0.000000e+00 3328
13 TraesCS6D01G079600 chr4D 95.319 235 6 4 1879 2111 207070648 207070417 3.310000e-98 368
14 TraesCS6D01G079600 chr4D 91.667 132 4 3 1978 2108 438220201 438220076 2.150000e-40 176


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G079600 chr6D 45509713 45511823 2110 True 3899 3899 100.000 1 2111 1 chr6D.!!$R1 2110
1 TraesCS6D01G079600 chr5D 503287048 503289171 2123 False 3655 3655 97.836 1 2111 1 chr5D.!!$F3 2110
2 TraesCS6D01G079600 chr5D 6179094 6181198 2104 True 3591 3591 97.452 1 2108 1 chr5D.!!$R1 2107
3 TraesCS6D01G079600 chr5D 120799620 120801720 2100 False 3537 3537 97.025 1 2108 1 chr5D.!!$F1 2107
4 TraesCS6D01G079600 chr5D 167071682 167073782 2100 False 3441 3441 96.174 1 2111 1 chr5D.!!$F2 2110
5 TraesCS6D01G079600 chr5D 512407768 512409297 1529 True 2678 2678 98.367 506 2025 1 chr5D.!!$R2 1519
6 TraesCS6D01G079600 chr5D 512414788 512416234 1446 True 2521 2521 98.272 506 1939 1 chr5D.!!$R3 1433
7 TraesCS6D01G079600 chr5D 513638969 513639950 981 True 1489 1489 93.762 1 1009 1 chr5D.!!$R4 1008
8 TraesCS6D01G079600 chr1D 254416813 254418914 2101 False 3611 3611 97.640 1 2109 1 chr1D.!!$F1 2108
9 TraesCS6D01G079600 chr1D 51876213 51878325 2112 True 3579 3579 97.264 1 2111 1 chr1D.!!$R1 2110
10 TraesCS6D01G079600 chr1D 260891855 260893405 1550 False 2505 2505 95.825 1 1552 1 chr1D.!!$F2 1551
11 TraesCS6D01G079600 chr1A 554458215 554460327 2112 False 3579 3579 97.274 1 2111 1 chr1A.!!$F1 2110
12 TraesCS6D01G079600 chr4A 309505295 309507385 2090 True 3328 3328 95.324 2 2108 1 chr4A.!!$R1 2106

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
56 57 0.392998 CCGCTGCCTTACCACTTGAT 60.393 55.0 0.0 0.0 0.0 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1910 1950 6.993308 GGTGGAAGAACTAAATAGAGGATTCC 59.007 42.308 0.0 0.0 35.37 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
55 56 1.003839 CCGCTGCCTTACCACTTGA 60.004 57.895 0.00 0.0 0.00 3.02
56 57 0.392998 CCGCTGCCTTACCACTTGAT 60.393 55.000 0.00 0.0 0.00 2.57
197 199 8.846943 ACACATGCGGATAATATAGAATCAAA 57.153 30.769 0.00 0.0 0.00 2.69
584 588 1.494824 CTTTGTTTGGCAAGCTGCTC 58.505 50.000 15.19 0.0 44.28 4.26
1539 1566 2.779755 TCTCTTTAGCGGGCATTTCA 57.220 45.000 0.00 0.0 0.00 2.69
1797 1831 1.715519 CCGCGCAAGACAAGAATTTTG 59.284 47.619 8.75 0.0 43.02 2.44
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
476 479 3.305744 GCTTCGGGTAATTTGGCAAAGAA 60.306 43.478 18.61 13.07 0.00 2.52
1797 1831 8.009974 ACAAGAATATGAAATCGTAAATAGCGC 58.990 33.333 0.00 0.00 0.00 5.92
1908 1948 8.925338 GTGGAAGAACTAAATAGAGGATTCCTA 58.075 37.037 4.86 0.00 35.73 2.94
1909 1949 7.147461 GGTGGAAGAACTAAATAGAGGATTCCT 60.147 40.741 4.44 4.44 35.73 3.36
1910 1950 6.993308 GGTGGAAGAACTAAATAGAGGATTCC 59.007 42.308 0.00 0.00 35.37 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.