Multiple sequence alignment - TraesCS6D01G079500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G079500 chr6D 100.000 3062 0 0 1 3062 45510494 45507433 0.000000e+00 5655
1 TraesCS6D01G079500 chr5D 97.855 3077 39 11 1 3062 503288378 503291442 0.000000e+00 5291
2 TraesCS6D01G079500 chr5D 97.102 3071 43 15 1 3062 6179869 6176836 0.000000e+00 5136
3 TraesCS6D01G079500 chr2B 97.153 2880 56 13 1 2870 474901405 474904268 0.000000e+00 4841
4 TraesCS6D01G079500 chr2B 96.417 307 9 2 97 402 25364566 25364261 3.520000e-139 505
5 TraesCS6D01G079500 chr4D 95.195 2518 100 8 550 3061 207070648 207068146 0.000000e+00 3960
6 TraesCS6D01G079500 chr2D 98.567 2164 20 8 1 2155 9786211 9788372 0.000000e+00 3814
7 TraesCS6D01G079500 chr2D 97.951 1562 23 4 1501 3062 638423033 638424585 0.000000e+00 2699
8 TraesCS6D01G079500 chr1A 97.583 2234 32 13 1 2221 554459536 554461760 0.000000e+00 3807
9 TraesCS6D01G079500 chr1A 98.352 1396 19 1 1667 3062 554461753 554463144 0.000000e+00 2447
10 TraesCS6D01G079500 chr1D 98.069 1968 33 2 1095 3062 254433152 254435114 0.000000e+00 3419
11 TraesCS6D01G079500 chr1D 97.279 1507 31 6 1 1500 51876998 51875495 0.000000e+00 2547
12 TraesCS6D01G079500 chr4B 95.932 1942 58 12 1 1936 308682705 308680779 0.000000e+00 3129
13 TraesCS6D01G079500 chr4B 96.639 1101 30 3 1962 3062 308680781 308679688 0.000000e+00 1821
14 TraesCS6D01G079500 chr5A 96.946 1670 40 10 1 1665 607199027 607197364 0.000000e+00 2791
15 TraesCS6D01G079500 chr5A 90.000 250 21 4 478 723 407122965 407123214 1.370000e-83 320
16 TraesCS6D01G079500 chr2A 97.407 270 2 2 1 266 334594989 334594721 3.600000e-124 455


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G079500 chr6D 45507433 45510494 3061 True 5655 5655 100.0000 1 3062 1 chr6D.!!$R1 3061
1 TraesCS6D01G079500 chr5D 503288378 503291442 3064 False 5291 5291 97.8550 1 3062 1 chr5D.!!$F1 3061
2 TraesCS6D01G079500 chr5D 6176836 6179869 3033 True 5136 5136 97.1020 1 3062 1 chr5D.!!$R1 3061
3 TraesCS6D01G079500 chr2B 474901405 474904268 2863 False 4841 4841 97.1530 1 2870 1 chr2B.!!$F1 2869
4 TraesCS6D01G079500 chr4D 207068146 207070648 2502 True 3960 3960 95.1950 550 3061 1 chr4D.!!$R1 2511
5 TraesCS6D01G079500 chr2D 9786211 9788372 2161 False 3814 3814 98.5670 1 2155 1 chr2D.!!$F1 2154
6 TraesCS6D01G079500 chr2D 638423033 638424585 1552 False 2699 2699 97.9510 1501 3062 1 chr2D.!!$F2 1561
7 TraesCS6D01G079500 chr1A 554459536 554463144 3608 False 3127 3807 97.9675 1 3062 2 chr1A.!!$F1 3061
8 TraesCS6D01G079500 chr1D 254433152 254435114 1962 False 3419 3419 98.0690 1095 3062 1 chr1D.!!$F1 1967
9 TraesCS6D01G079500 chr1D 51875495 51876998 1503 True 2547 2547 97.2790 1 1500 1 chr1D.!!$R1 1499
10 TraesCS6D01G079500 chr4B 308679688 308682705 3017 True 2475 3129 96.2855 1 3062 2 chr4B.!!$R1 3061
11 TraesCS6D01G079500 chr5A 607197364 607199027 1663 True 2791 2791 96.9460 1 1665 1 chr5A.!!$R1 1664

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
468 489 1.715519 CCGCGCAAGACAAGAATTTTG 59.284 47.619 8.75 0.0 43.02 2.44 F
966 1035 3.181475 GGAAAGTGATATGAGGTGCTCGA 60.181 47.826 0.00 0.0 32.35 4.04 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1405 1474 1.173043 TAAGGCCGCAATTGAACAGG 58.827 50.000 10.34 7.42 0.0 4.00 R
2743 3371 1.135257 TGCCAAATTCCGCCAAATACG 60.135 47.619 0.00 0.00 0.0 3.06 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
210 225 2.779755 TCTCTTTAGCGGGCATTTCA 57.220 45.000 0.00 0.0 0.00 2.69
468 489 1.715519 CCGCGCAAGACAAGAATTTTG 59.284 47.619 8.75 0.0 43.02 2.44
966 1035 3.181475 GGAAAGTGATATGAGGTGCTCGA 60.181 47.826 0.00 0.0 32.35 4.04
1405 1474 1.701704 CCAATTTGAACTTGCTCGGC 58.298 50.000 0.00 0.0 0.00 5.54
1882 2498 3.084786 GTTGGCTTGGCTCTGAACTTAT 58.915 45.455 0.00 0.0 0.00 1.73
1921 2537 2.034879 CAGGAAATCCGTGCAGCGT 61.035 57.895 7.68 0.0 42.08 5.07
1922 2538 1.302511 AGGAAATCCGTGCAGCGTT 60.303 52.632 7.68 0.0 42.08 4.84
2311 2927 2.884179 TAGGTTGGGGAGTAGGGCCG 62.884 65.000 0.00 0.0 0.00 6.13
2743 3371 3.406764 TGCATGGTTGGGTTTTATTTGC 58.593 40.909 0.00 0.0 0.00 3.68
2807 3435 1.226018 GCTCGCCGTGCATTTGTAC 60.226 57.895 6.24 0.0 0.00 2.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
468 489 8.009974 ACAAGAATATGAAATCGTAAATAGCGC 58.990 33.333 0.00 0.00 0.00 5.92
578 600 9.676129 TGGAAGAACTAAATAGAGGATTCCTAT 57.324 33.333 4.86 4.94 35.73 2.57
580 602 7.147461 GGTGGAAGAACTAAATAGAGGATTCCT 60.147 40.741 4.44 4.44 35.73 3.36
581 603 6.993308 GGTGGAAGAACTAAATAGAGGATTCC 59.007 42.308 0.00 0.00 35.37 3.01
1211 1280 5.041951 TGCTGCGGTTAAGAAATTACAAG 57.958 39.130 0.00 0.00 0.00 3.16
1405 1474 1.173043 TAAGGCCGCAATTGAACAGG 58.827 50.000 10.34 7.42 0.00 4.00
1882 2498 3.153919 GGGAAACAAAGTCATAGGCACA 58.846 45.455 0.00 0.00 0.00 4.57
1921 2537 9.877178 GTAGAAAGTCTCAAATTCAGGATCTAA 57.123 33.333 0.00 0.00 0.00 2.10
1922 2538 9.035890 TGTAGAAAGTCTCAAATTCAGGATCTA 57.964 33.333 0.00 0.00 0.00 1.98
2311 2927 4.201894 AGTATCTAGAACTTCCCTCCCC 57.798 50.000 0.00 0.00 0.00 4.81
2724 3352 3.658709 ACGCAAATAAAACCCAACCATG 58.341 40.909 0.00 0.00 0.00 3.66
2725 3353 5.669164 ATACGCAAATAAAACCCAACCAT 57.331 34.783 0.00 0.00 0.00 3.55
2726 3354 5.470047 AATACGCAAATAAAACCCAACCA 57.530 34.783 0.00 0.00 0.00 3.67
2727 3355 5.120986 CCAAATACGCAAATAAAACCCAACC 59.879 40.000 0.00 0.00 0.00 3.77
2743 3371 1.135257 TGCCAAATTCCGCCAAATACG 60.135 47.619 0.00 0.00 0.00 3.06
2807 3435 3.139077 ACAAGTAAGCTTCTCCAAACCG 58.861 45.455 0.00 0.00 31.49 4.44
2811 3439 8.135382 ACTATAAGACAAGTAAGCTTCTCCAA 57.865 34.615 0.00 0.00 31.49 3.53


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.