Multiple sequence alignment - TraesCS6D01G078400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G078400 chr6D 100.000 2293 0 0 1 2293 43532743 43530451 0 4235
1 TraesCS6D01G078400 chr4D 96.741 1381 36 5 1 1373 460570756 460572135 0 2292
2 TraesCS6D01G078400 chr4D 95.662 922 30 6 1373 2293 412686236 412687148 0 1472
3 TraesCS6D01G078400 chr7D 96.866 1372 35 4 4 1373 80966882 80965517 0 2289
4 TraesCS6D01G078400 chr7D 95.614 1368 54 4 8 1373 166227734 166229097 0 2189
5 TraesCS6D01G078400 chr7D 95.671 924 29 4 1374 2293 80134308 80133392 0 1474
6 TraesCS6D01G078400 chr1D 95.148 1381 58 5 2 1373 450517434 450518814 0 2170
7 TraesCS6D01G078400 chr1D 95.508 935 22 7 1374 2293 49500967 49501896 0 1476
8 TraesCS6D01G078400 chr4B 95.138 1378 59 4 4 1373 346147229 346145852 0 2167
9 TraesCS6D01G078400 chr4B 94.931 1381 60 6 2 1373 412185509 412186888 0 2154
10 TraesCS6D01G078400 chr2D 94.939 1383 59 9 1 1373 192147178 192145797 0 2156
11 TraesCS6D01G078400 chr2D 95.978 920 30 6 1374 2293 626912081 626912993 0 1487
12 TraesCS6D01G078400 chr2D 95.606 933 28 8 1371 2293 605233241 605234170 0 1483
13 TraesCS6D01G078400 chr2D 95.386 932 30 7 1374 2293 617486669 617487599 0 1471
14 TraesCS6D01G078400 chr2B 94.840 1376 61 6 6 1373 142606971 142608344 0 2139
15 TraesCS6D01G078400 chr6B 94.710 1380 64 4 2 1373 170871749 170873127 0 2135
16 TraesCS6D01G078400 chr3D 96.444 928 21 6 1374 2293 574587216 574586293 0 1520
17 TraesCS6D01G078400 chr5D 95.587 929 30 5 1373 2293 325399476 325398551 0 1478
18 TraesCS6D01G078400 chr5D 95.361 927 34 5 1373 2293 524118599 524117676 0 1465


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G078400 chr6D 43530451 43532743 2292 True 4235 4235 100.000 1 2293 1 chr6D.!!$R1 2292
1 TraesCS6D01G078400 chr4D 460570756 460572135 1379 False 2292 2292 96.741 1 1373 1 chr4D.!!$F2 1372
2 TraesCS6D01G078400 chr4D 412686236 412687148 912 False 1472 1472 95.662 1373 2293 1 chr4D.!!$F1 920
3 TraesCS6D01G078400 chr7D 80965517 80966882 1365 True 2289 2289 96.866 4 1373 1 chr7D.!!$R2 1369
4 TraesCS6D01G078400 chr7D 166227734 166229097 1363 False 2189 2189 95.614 8 1373 1 chr7D.!!$F1 1365
5 TraesCS6D01G078400 chr7D 80133392 80134308 916 True 1474 1474 95.671 1374 2293 1 chr7D.!!$R1 919
6 TraesCS6D01G078400 chr1D 450517434 450518814 1380 False 2170 2170 95.148 2 1373 1 chr1D.!!$F2 1371
7 TraesCS6D01G078400 chr1D 49500967 49501896 929 False 1476 1476 95.508 1374 2293 1 chr1D.!!$F1 919
8 TraesCS6D01G078400 chr4B 346145852 346147229 1377 True 2167 2167 95.138 4 1373 1 chr4B.!!$R1 1369
9 TraesCS6D01G078400 chr4B 412185509 412186888 1379 False 2154 2154 94.931 2 1373 1 chr4B.!!$F1 1371
10 TraesCS6D01G078400 chr2D 192145797 192147178 1381 True 2156 2156 94.939 1 1373 1 chr2D.!!$R1 1372
11 TraesCS6D01G078400 chr2D 626912081 626912993 912 False 1487 1487 95.978 1374 2293 1 chr2D.!!$F3 919
12 TraesCS6D01G078400 chr2D 605233241 605234170 929 False 1483 1483 95.606 1371 2293 1 chr2D.!!$F1 922
13 TraesCS6D01G078400 chr2D 617486669 617487599 930 False 1471 1471 95.386 1374 2293 1 chr2D.!!$F2 919
14 TraesCS6D01G078400 chr2B 142606971 142608344 1373 False 2139 2139 94.840 6 1373 1 chr2B.!!$F1 1367
15 TraesCS6D01G078400 chr6B 170871749 170873127 1378 False 2135 2135 94.710 2 1373 1 chr6B.!!$F1 1371
16 TraesCS6D01G078400 chr3D 574586293 574587216 923 True 1520 1520 96.444 1374 2293 1 chr3D.!!$R1 919
17 TraesCS6D01G078400 chr5D 325398551 325399476 925 True 1478 1478 95.587 1373 2293 1 chr5D.!!$R1 920
18 TraesCS6D01G078400 chr5D 524117676 524118599 923 True 1465 1465 95.361 1373 2293 1 chr5D.!!$R2 920

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
293 302 0.989602 GTTGGTGCTAGGGTTAGGGT 59.01 55.0 0.0 0.0 0.0 4.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1485 1499 2.100631 CATCTGTCCCGGTTCGTGC 61.101 63.158 0.0 0.0 0.0 5.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
246 249 8.721133 TCCTATGATTAGGCTTGTTAGTATGA 57.279 34.615 0.00 0.00 44.20 2.15
293 302 0.989602 GTTGGTGCTAGGGTTAGGGT 59.010 55.000 0.00 0.00 0.00 4.34
323 332 2.444388 GGGTTATGGTTAGGGTTAGGGG 59.556 54.545 0.00 0.00 0.00 4.79
521 532 1.955778 TGAGCTTGACATGGTGTTTGG 59.044 47.619 0.00 0.00 0.00 3.28
557 568 1.208614 CGGAGCTCTTGCAACAAGC 59.791 57.895 14.64 17.48 42.74 4.01
805 817 1.682087 CCCCTTTGGTTGCTAGTAGCC 60.682 57.143 19.41 6.77 41.51 3.93
976 988 3.181446 TGACAACAATGTGGGTGATCTCA 60.181 43.478 0.00 0.00 40.74 3.27
1025 1037 3.399305 GACCATTCCATCCCTTATTCCCT 59.601 47.826 0.00 0.00 0.00 4.20
1038 1050 4.401022 CTTATTCCCTTGGCTATGCATCA 58.599 43.478 0.19 0.00 0.00 3.07
1159 1172 6.538742 CGGACTACATTGTTCAAGGATGTTAT 59.461 38.462 4.26 0.00 35.72 1.89
1163 1176 9.520515 ACTACATTGTTCAAGGATGTTATTCTT 57.479 29.630 4.26 0.00 35.72 2.52
1229 1242 0.324943 TTAGGCCAAGCTCTCACCAC 59.675 55.000 5.01 0.00 0.00 4.16
1322 1336 2.143122 TCGACAACTACTCGGTTACGT 58.857 47.619 0.00 0.00 41.85 3.57
1352 1366 0.539986 ACACAAGGTGGTGAACTCGT 59.460 50.000 0.00 0.00 41.32 4.18
1357 1371 1.035139 AGGTGGTGAACTCGTACGTT 58.965 50.000 16.05 2.55 0.00 3.99
1386 1400 4.103357 CGCTACACGCACTAGTAGAAAAT 58.897 43.478 3.59 0.00 40.02 1.82
1485 1499 1.350019 ACCCTTTAGTCCCGGTTCTTG 59.650 52.381 0.00 0.00 0.00 3.02
1822 1862 6.930722 AGATCGTCATGAACATATGCATACAA 59.069 34.615 8.99 0.00 0.00 2.41
1994 2034 6.070995 TCCACATAGTATTCTCCGTTTTCAGT 60.071 38.462 0.00 0.00 0.00 3.41
1998 2038 8.041323 ACATAGTATTCTCCGTTTTCAGTGATT 58.959 33.333 0.00 0.00 0.00 2.57
2259 2309 1.717194 GGATGGACTCGCAAACGTAA 58.283 50.000 0.00 0.00 41.18 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
246 249 7.707467 AGAACACCCATAAGAATAACCCTAT 57.293 36.000 0.00 0.0 0.00 2.57
293 302 4.977090 CCCTAACCATAACCCTAACCCTAA 59.023 45.833 0.00 0.0 0.00 2.69
521 532 3.672808 TCCGCATAGCTAGGACTACTAC 58.327 50.000 10.11 0.0 0.00 2.73
557 568 5.357878 TCCATCCAATTCAAATCTTTCCTCG 59.642 40.000 0.00 0.0 0.00 4.63
805 817 3.628646 CTCGCTTCAAGGGTGGGGG 62.629 68.421 0.72 0.0 0.00 5.40
871 883 3.070302 TCTTGGTTGTTTGTAAATGGGCC 59.930 43.478 0.00 0.0 0.00 5.80
976 988 9.146984 CATTGTCTCTTGCAAATGATATTTGTT 57.853 29.630 13.82 0.0 0.00 2.83
1025 1037 2.104622 TCCGAATCTGATGCATAGCCAA 59.895 45.455 0.00 0.0 0.00 4.52
1159 1172 3.889227 CGGCTTCATCCGCAAGAA 58.111 55.556 0.00 0.0 43.18 2.52
1229 1242 3.421826 CGGTTCTTGTCGTCTTCAAATCG 60.422 47.826 0.00 0.0 0.00 3.34
1401 1415 2.594131 GACAAAAGGCCCTTACCAACT 58.406 47.619 0.00 0.0 0.00 3.16
1485 1499 2.100631 CATCTGTCCCGGTTCGTGC 61.101 63.158 0.00 0.0 0.00 5.34
1822 1862 4.282496 AGGTGGTCGATATCACTTCTCTT 58.718 43.478 3.12 0.0 36.90 2.85
1994 2034 4.610605 TTCTTCCTTGACCACGTAATCA 57.389 40.909 0.00 0.0 0.00 2.57
1998 2038 2.614481 GGCATTCTTCCTTGACCACGTA 60.614 50.000 0.00 0.0 0.00 3.57
2259 2309 6.676558 ACAAGGGAATGATTTCTGTGGATAT 58.323 36.000 0.00 0.0 32.16 1.63


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.