Multiple sequence alignment - TraesCS6D01G074900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G074900 chr6D 100.000 2903 0 0 1 2903 38581743 38584645 0.000000e+00 5361
1 TraesCS6D01G074900 chr6B 96.419 1424 50 1 884 2307 89695860 89697282 0.000000e+00 2346
2 TraesCS6D01G074900 chr6B 94.970 338 15 1 2568 2903 89697632 89697969 1.980000e-146 529
3 TraesCS6D01G074900 chr6B 91.386 267 23 0 2306 2572 89697337 89697603 1.640000e-97 366
4 TraesCS6D01G074900 chrUn 97.278 1249 31 3 1656 2903 114253139 114251893 0.000000e+00 2115
5 TraesCS6D01G074900 chrUn 96.169 783 30 0 878 1660 114262980 114262198 0.000000e+00 1280
6 TraesCS6D01G074900 chr1D 98.167 873 14 2 1 873 226466534 226467404 0.000000e+00 1522
7 TraesCS6D01G074900 chr1D 97.480 873 20 1 1 873 452233794 452234664 0.000000e+00 1489
8 TraesCS6D01G074900 chr1D 97.055 883 24 2 1 883 495116746 495115866 0.000000e+00 1485
9 TraesCS6D01G074900 chr7D 97.605 877 18 3 1 876 23679818 23680692 0.000000e+00 1500
10 TraesCS6D01G074900 chr7D 97.709 873 18 1 1 873 264048659 264047789 0.000000e+00 1500
11 TraesCS6D01G074900 chr7D 97.282 883 21 2 1 880 496101176 496100294 0.000000e+00 1495
12 TraesCS6D01G074900 chr2D 97.709 873 19 1 1 873 36685642 36686513 0.000000e+00 1500
13 TraesCS6D01G074900 chr2D 97.480 873 21 1 1 873 346285586 346286457 0.000000e+00 1489
14 TraesCS6D01G074900 chr2D 80.072 557 101 8 880 1428 620398989 620398435 3.480000e-109 405
15 TraesCS6D01G074900 chr2D 74.910 558 116 21 878 1422 17955395 17955941 1.740000e-57 233
16 TraesCS6D01G074900 chr5D 97.365 873 21 1 1 873 432795665 432796535 0.000000e+00 1483
17 TraesCS6D01G074900 chr3D 88.245 1225 134 6 876 2095 85062154 85060935 0.000000e+00 1456
18 TraesCS6D01G074900 chr3B 88.058 1231 132 8 876 2095 130647765 130646539 0.000000e+00 1445
19 TraesCS6D01G074900 chr3B 87.785 1228 124 11 876 2095 134275419 134274210 0.000000e+00 1413
20 TraesCS6D01G074900 chr3A 87.876 1229 135 12 876 2095 102116611 102115388 0.000000e+00 1432
21 TraesCS6D01G074900 chr2B 78.189 1027 192 23 880 1884 760829540 760828524 6.830000e-176 627
22 TraesCS6D01G074900 chr2A 75.448 558 113 21 878 1422 19125421 19125967 1.730000e-62 250


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G074900 chr6D 38581743 38584645 2902 False 5361.000000 5361 100.000000 1 2903 1 chr6D.!!$F1 2902
1 TraesCS6D01G074900 chr6B 89695860 89697969 2109 False 1080.333333 2346 94.258333 884 2903 3 chr6B.!!$F1 2019
2 TraesCS6D01G074900 chrUn 114251893 114253139 1246 True 2115.000000 2115 97.278000 1656 2903 1 chrUn.!!$R1 1247
3 TraesCS6D01G074900 chrUn 114262198 114262980 782 True 1280.000000 1280 96.169000 878 1660 1 chrUn.!!$R2 782
4 TraesCS6D01G074900 chr1D 226466534 226467404 870 False 1522.000000 1522 98.167000 1 873 1 chr1D.!!$F1 872
5 TraesCS6D01G074900 chr1D 452233794 452234664 870 False 1489.000000 1489 97.480000 1 873 1 chr1D.!!$F2 872
6 TraesCS6D01G074900 chr1D 495115866 495116746 880 True 1485.000000 1485 97.055000 1 883 1 chr1D.!!$R1 882
7 TraesCS6D01G074900 chr7D 23679818 23680692 874 False 1500.000000 1500 97.605000 1 876 1 chr7D.!!$F1 875
8 TraesCS6D01G074900 chr7D 264047789 264048659 870 True 1500.000000 1500 97.709000 1 873 1 chr7D.!!$R1 872
9 TraesCS6D01G074900 chr7D 496100294 496101176 882 True 1495.000000 1495 97.282000 1 880 1 chr7D.!!$R2 879
10 TraesCS6D01G074900 chr2D 36685642 36686513 871 False 1500.000000 1500 97.709000 1 873 1 chr2D.!!$F2 872
11 TraesCS6D01G074900 chr2D 346285586 346286457 871 False 1489.000000 1489 97.480000 1 873 1 chr2D.!!$F3 872
12 TraesCS6D01G074900 chr2D 620398435 620398989 554 True 405.000000 405 80.072000 880 1428 1 chr2D.!!$R1 548
13 TraesCS6D01G074900 chr2D 17955395 17955941 546 False 233.000000 233 74.910000 878 1422 1 chr2D.!!$F1 544
14 TraesCS6D01G074900 chr5D 432795665 432796535 870 False 1483.000000 1483 97.365000 1 873 1 chr5D.!!$F1 872
15 TraesCS6D01G074900 chr3D 85060935 85062154 1219 True 1456.000000 1456 88.245000 876 2095 1 chr3D.!!$R1 1219
16 TraesCS6D01G074900 chr3B 130646539 130647765 1226 True 1445.000000 1445 88.058000 876 2095 1 chr3B.!!$R1 1219
17 TraesCS6D01G074900 chr3B 134274210 134275419 1209 True 1413.000000 1413 87.785000 876 2095 1 chr3B.!!$R2 1219
18 TraesCS6D01G074900 chr3A 102115388 102116611 1223 True 1432.000000 1432 87.876000 876 2095 1 chr3A.!!$R1 1219
19 TraesCS6D01G074900 chr2B 760828524 760829540 1016 True 627.000000 627 78.189000 880 1884 1 chr2B.!!$R1 1004
20 TraesCS6D01G074900 chr2A 19125421 19125967 546 False 250.000000 250 75.448000 878 1422 1 chr2A.!!$F1 544

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
856 862 0.040204 CCTTGGCCCTCCTGTGAATT 59.96 55.0 0.0 0.0 0.0 2.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2370 2463 1.13379 GATCACCTTCACATTGCCTGC 59.866 52.381 0.0 0.0 0.0 4.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
112 113 0.755698 ACCCCACTCGCTATCGTCAT 60.756 55.000 0.00 0.00 36.96 3.06
236 237 3.904717 AGTCATCTCCTCCGTGTTCTAT 58.095 45.455 0.00 0.00 0.00 1.98
251 252 5.533482 GTGTTCTATGATATCTTCGTGGCT 58.467 41.667 3.98 0.00 0.00 4.75
265 266 2.268802 TGGCTCGCTCTCTCAACGT 61.269 57.895 0.00 0.00 0.00 3.99
476 477 3.947132 CTGCTGACGGCTGAGGTGG 62.947 68.421 7.96 0.00 41.52 4.61
543 544 2.101582 CCTCGACTCCCTTATTGTCAGG 59.898 54.545 0.00 0.00 0.00 3.86
586 587 3.041940 CGTGACCCGGTGAAGCAC 61.042 66.667 0.00 0.00 0.00 4.40
587 588 2.110213 GTGACCCGGTGAAGCACA 59.890 61.111 0.00 0.00 35.86 4.57
773 774 4.074259 TGTTGATCCACCATGAGTTTGAG 58.926 43.478 0.00 0.00 0.00 3.02
856 862 0.040204 CCTTGGCCCTCCTGTGAATT 59.960 55.000 0.00 0.00 0.00 2.17
857 863 1.180029 CTTGGCCCTCCTGTGAATTG 58.820 55.000 0.00 0.00 0.00 2.32
873 879 4.016444 TGAATTGAGTTGCCCATTCCTAC 58.984 43.478 0.00 0.00 0.00 3.18
874 880 3.737559 ATTGAGTTGCCCATTCCTACA 57.262 42.857 0.00 0.00 0.00 2.74
908 914 0.248825 CTCGCGGAGAAGAGGTCATG 60.249 60.000 6.13 0.00 31.91 3.07
979 985 3.101437 TCATCAAATGGCTGGCTGATTT 58.899 40.909 2.00 0.00 0.00 2.17
1146 1154 2.269978 GGAGCACCGTAGTACCACA 58.730 57.895 0.00 0.00 0.00 4.17
1188 1205 0.248907 GCGAGCTGCGACAATACCTA 60.249 55.000 9.32 0.00 44.57 3.08
1238 1256 1.227380 CCACAGGAGGCTACATCGC 60.227 63.158 0.00 0.00 0.00 4.58
1313 1331 0.846693 AAGTGGACCTGGCTGAAACT 59.153 50.000 0.00 0.00 0.00 2.66
1320 1338 0.517316 CCTGGCTGAAACTACGTTGC 59.483 55.000 0.00 0.00 0.00 4.17
1928 1954 9.401058 AGTTTTTCTTCCTGTCCAGATAATATG 57.599 33.333 0.00 0.00 0.00 1.78
2239 2276 7.553402 GCCTCTTATTCATATAGGTCGAGACTA 59.447 40.741 3.09 0.00 0.00 2.59
2269 2306 6.672593 ACATTTTGGCCTATGGAGAATCTAA 58.327 36.000 3.32 0.00 33.73 2.10
2356 2449 2.028748 ACAGATGCTTTTTGACCATGGC 60.029 45.455 13.04 5.35 0.00 4.40
2370 2463 1.024271 CATGGCAAACTGGTATCGGG 58.976 55.000 0.00 0.00 0.00 5.14
2513 2606 6.316390 ACCAAAGCTAAATACATAGAGCACAC 59.684 38.462 0.00 0.00 37.40 3.82
2519 2612 6.088749 GCTAAATACATAGAGCACACTGATCG 59.911 42.308 0.00 0.00 37.94 3.69
2660 2788 8.565416 ACAGTTAGCTTCACATACCTTAAAAAC 58.435 33.333 0.00 0.00 0.00 2.43
2719 2847 9.797642 AATATGCACAAATCATTACCAGATAGA 57.202 29.630 0.00 0.00 0.00 1.98
2748 2876 4.928661 TTCTAACGATTGCAGCTTCTTC 57.071 40.909 0.00 0.00 0.00 2.87
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
72 73 0.119155 AGGGAGAGGGTCACCATCAA 59.881 55.000 11.94 0.00 40.13 2.57
112 113 4.284490 AGATAGACAAGACTGCCAACAAGA 59.716 41.667 0.00 0.00 0.00 3.02
236 237 1.001268 GAGCGAGCCACGAAGATATCA 60.001 52.381 5.32 0.00 45.77 2.15
251 252 2.293677 AGAAAAGACGTTGAGAGAGCGA 59.706 45.455 0.00 0.00 0.00 4.93
265 266 0.768622 TGGAGCGGGGAAAGAAAAGA 59.231 50.000 0.00 0.00 0.00 2.52
476 477 3.062042 CAAGTAACCACCGTAACCAGAC 58.938 50.000 0.00 0.00 0.00 3.51
543 544 2.969628 ACTGATAGCACCAGTACTGC 57.030 50.000 17.86 7.43 42.51 4.40
856 862 1.338674 CGTGTAGGAATGGGCAACTCA 60.339 52.381 0.00 0.00 0.00 3.41
857 863 1.338769 ACGTGTAGGAATGGGCAACTC 60.339 52.381 0.00 0.00 0.00 3.01
908 914 0.390472 CTCCGGGAGAGTCAACTTGC 60.390 60.000 19.57 0.00 37.87 4.01
979 985 0.034089 TCGGACCTCTCATCAGCAGA 60.034 55.000 0.00 0.00 0.00 4.26
1061 1069 1.305201 GAAAACGGGAGTCACTTGCA 58.695 50.000 0.00 0.00 46.69 4.08
1146 1154 0.671251 GATCGACGGCTTGAGGATCT 59.329 55.000 0.00 0.00 34.92 2.75
1188 1205 9.995003 TCATAAAATACAAATGCCTTTTTCTGT 57.005 25.926 0.00 0.00 0.00 3.41
1238 1256 3.732212 TCTGGATCATGAATAAGCACCG 58.268 45.455 0.00 0.00 0.00 4.94
1549 1572 2.764010 AGGTATAGTGGACATGCGTTGA 59.236 45.455 0.00 0.00 0.00 3.18
1928 1954 8.260270 TGCATTACATCATCTGCTATACAATC 57.740 34.615 0.00 0.00 35.66 2.67
2239 2276 3.829601 TCCATAGGCCAAAATGTCGTTTT 59.170 39.130 5.01 0.00 40.59 2.43
2356 2449 1.376609 GCCTGCCCGATACCAGTTTG 61.377 60.000 0.00 0.00 0.00 2.93
2370 2463 1.133790 GATCACCTTCACATTGCCTGC 59.866 52.381 0.00 0.00 0.00 4.85
2660 2788 7.308229 CCCACTTTATAGCAAAGCTAGCATTAG 60.308 40.741 18.83 6.19 44.66 1.73
2719 2847 5.643777 AGCTGCAATCGTTAGAAATACTTGT 59.356 36.000 1.02 0.00 0.00 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.