Multiple sequence alignment - TraesCS6D01G065500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G065500 chr6D 100.000 2911 0 0 1 2911 32039174 32036264 0.000000e+00 5376
1 TraesCS6D01G065500 chr6D 99.107 2911 23 2 1 2911 433250792 433253699 0.000000e+00 5228
2 TraesCS6D01G065500 chr6D 97.685 1382 29 2 71 1450 420713332 420714712 0.000000e+00 2372
3 TraesCS6D01G065500 chr6D 97.465 868 20 2 1509 2374 420714702 420715569 0.000000e+00 1480
4 TraesCS6D01G065500 chr2B 97.836 2911 57 4 1 2911 616459236 616462140 0.000000e+00 5022
5 TraesCS6D01G065500 chr2B 93.033 1464 79 12 445 1901 63131876 63130429 0.000000e+00 2117
6 TraesCS6D01G065500 chr2A 97.253 2621 55 8 295 2911 605004802 605002195 0.000000e+00 4425
7 TraesCS6D01G065500 chr5A 97.152 2142 46 7 295 2432 539077469 539075339 0.000000e+00 3603
8 TraesCS6D01G065500 chr5A 92.708 1920 96 14 1 1901 139476947 139475053 0.000000e+00 2730
9 TraesCS6D01G065500 chr5A 93.178 601 37 2 2008 2607 139472293 139471696 0.000000e+00 880
10 TraesCS6D01G065500 chr5A 95.567 406 17 1 2507 2911 539075344 539074939 0.000000e+00 649
11 TraesCS6D01G065500 chr4B 93.243 1924 82 25 1 1901 74348680 74350578 0.000000e+00 2789
12 TraesCS6D01G065500 chr4D 92.816 1921 91 15 1 1901 403008888 403010781 0.000000e+00 2739
13 TraesCS6D01G065500 chr4D 92.258 310 23 1 2603 2911 403014224 403014533 3.440000e-119 438
14 TraesCS6D01G065500 chr2D 92.708 1920 93 17 1 1901 644817658 644819549 0.000000e+00 2726
15 TraesCS6D01G065500 chr2D 93.522 602 34 3 2008 2607 644822345 644822943 0.000000e+00 891
16 TraesCS6D01G065500 chr7D 92.552 1920 94 16 1 1901 29571829 29569940 0.000000e+00 2708
17 TraesCS6D01G065500 chr7D 94.000 600 30 4 2011 2607 29567141 29566545 0.000000e+00 904
18 TraesCS6D01G065500 chr7D 92.581 310 22 1 2603 2911 29566407 29566098 7.400000e-121 444
19 TraesCS6D01G065500 chr6A 92.761 1492 71 14 1 1472 615073953 615072479 0.000000e+00 2122
20 TraesCS6D01G065500 chr1A 84.885 1310 157 28 724 2022 50508945 50510224 0.000000e+00 1284
21 TraesCS6D01G065500 chr3D 91.854 712 35 5 1 701 107205553 107206252 0.000000e+00 972
22 TraesCS6D01G065500 chr6B 92.593 648 33 4 5 641 128934664 128934021 0.000000e+00 917
23 TraesCS6D01G065500 chr1D 93.023 602 37 3 2008 2607 187813048 187813646 0.000000e+00 874
24 TraesCS6D01G065500 chr1D 93.226 310 20 1 2603 2911 187813784 187814093 3.420000e-124 455
25 TraesCS6D01G065500 chr7B 93.769 337 19 1 445 781 400460381 400460047 3.350000e-139 505
26 TraesCS6D01G065500 chr4A 92.013 313 24 1 2599 2911 572502638 572502949 3.440000e-119 438


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G065500 chr6D 32036264 32039174 2910 True 5376.0 5376 100.000000 1 2911 1 chr6D.!!$R1 2910
1 TraesCS6D01G065500 chr6D 433250792 433253699 2907 False 5228.0 5228 99.107000 1 2911 1 chr6D.!!$F1 2910
2 TraesCS6D01G065500 chr6D 420713332 420715569 2237 False 1926.0 2372 97.575000 71 2374 2 chr6D.!!$F2 2303
3 TraesCS6D01G065500 chr2B 616459236 616462140 2904 False 5022.0 5022 97.836000 1 2911 1 chr2B.!!$F1 2910
4 TraesCS6D01G065500 chr2B 63130429 63131876 1447 True 2117.0 2117 93.033000 445 1901 1 chr2B.!!$R1 1456
5 TraesCS6D01G065500 chr2A 605002195 605004802 2607 True 4425.0 4425 97.253000 295 2911 1 chr2A.!!$R1 2616
6 TraesCS6D01G065500 chr5A 539074939 539077469 2530 True 2126.0 3603 96.359500 295 2911 2 chr5A.!!$R2 2616
7 TraesCS6D01G065500 chr5A 139471696 139476947 5251 True 1805.0 2730 92.943000 1 2607 2 chr5A.!!$R1 2606
8 TraesCS6D01G065500 chr4B 74348680 74350578 1898 False 2789.0 2789 93.243000 1 1901 1 chr4B.!!$F1 1900
9 TraesCS6D01G065500 chr4D 403008888 403014533 5645 False 1588.5 2739 92.537000 1 2911 2 chr4D.!!$F1 2910
10 TraesCS6D01G065500 chr2D 644817658 644822943 5285 False 1808.5 2726 93.115000 1 2607 2 chr2D.!!$F1 2606
11 TraesCS6D01G065500 chr7D 29566098 29571829 5731 True 1352.0 2708 93.044333 1 2911 3 chr7D.!!$R1 2910
12 TraesCS6D01G065500 chr6A 615072479 615073953 1474 True 2122.0 2122 92.761000 1 1472 1 chr6A.!!$R1 1471
13 TraesCS6D01G065500 chr1A 50508945 50510224 1279 False 1284.0 1284 84.885000 724 2022 1 chr1A.!!$F1 1298
14 TraesCS6D01G065500 chr3D 107205553 107206252 699 False 972.0 972 91.854000 1 701 1 chr3D.!!$F1 700
15 TraesCS6D01G065500 chr6B 128934021 128934664 643 True 917.0 917 92.593000 5 641 1 chr6B.!!$R1 636
16 TraesCS6D01G065500 chr1D 187813048 187814093 1045 False 664.5 874 93.124500 2008 2911 2 chr1D.!!$F1 903

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1050 1077 4.344865 GCCACCCACCACGACCAT 62.345 66.667 0.0 0.0 0.0 3.55 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2503 5283 1.854507 AAAGCTTGGAGAGGCCCCT 60.855 57.895 0.0 0.0 34.97 4.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1050 1077 4.344865 GCCACCCACCACGACCAT 62.345 66.667 0.00 0.00 0.00 3.55
1200 1227 1.911293 CTTGACATTGTGGTCGGCGG 61.911 60.000 7.21 0.00 40.72 6.13
1681 1720 1.092345 GCACCGAAGAGAAGGATGCC 61.092 60.000 0.00 0.00 0.00 4.40
1834 1884 9.531942 TTGTAATTATGCATGATTTTGATGGAC 57.468 29.630 20.36 11.71 0.00 4.02
2503 5283 5.071788 TCCTTCTGAGCCAAGAAAAGTAGAA 59.928 40.000 0.83 0.00 35.79 2.10
2511 5291 3.348119 CAAGAAAAGTAGAAGGGGCCTC 58.652 50.000 0.84 0.00 0.00 4.70
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
383 390 9.690913 TTCAAAGTCCTAGTATACTGCTTACTA 57.309 33.333 15.90 0.0 32.35 1.82
599 619 3.252215 TGCAAGAAACCATGTAAAGTCCG 59.748 43.478 0.00 0.0 0.00 4.79
856 883 6.906659 ACTGAATGAAGAAACAGTAAGCATG 58.093 36.000 0.00 0.0 40.96 4.06
1050 1077 4.445452 GGACATACCTTGTACAACTCGA 57.555 45.455 3.59 0.0 39.20 4.04
1529 1565 8.303156 TGTCCACCATGTTTCATTTTGTATTAG 58.697 33.333 0.00 0.0 0.00 1.73
2503 5283 1.854507 AAAGCTTGGAGAGGCCCCT 60.855 57.895 0.00 0.0 34.97 4.79
2511 5291 5.762218 CCCATCTACTATTCAAAGCTTGGAG 59.238 44.000 3.21 0.0 0.00 3.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.