Multiple sequence alignment - TraesCS6D01G065000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G065000 chr6D 100.000 2411 0 0 1 2411 31723986 31726396 0.000000e+00 4453.0
1 TraesCS6D01G065000 chr6D 82.920 767 115 10 580 1333 62079877 62079114 0.000000e+00 676.0
2 TraesCS6D01G065000 chr3D 99.088 2412 20 2 1 2411 367917073 367919483 0.000000e+00 4331.0
3 TraesCS6D01G065000 chr3D 88.316 873 94 7 1439 2306 609176462 609177331 0.000000e+00 1040.0
4 TraesCS6D01G065000 chr3D 92.250 529 34 5 47 569 609175307 609175834 0.000000e+00 743.0
5 TraesCS6D01G065000 chr5B 94.810 1079 36 5 1 1073 40316568 40317632 0.000000e+00 1664.0
6 TraesCS6D01G065000 chr5B 94.625 1079 38 5 1 1073 40211286 40212350 0.000000e+00 1653.0
7 TraesCS6D01G065000 chr2A 94.732 1044 36 9 406 1436 457493472 457492435 0.000000e+00 1605.0
8 TraesCS6D01G065000 chr2A 95.222 879 35 4 1433 2306 490189098 490189974 0.000000e+00 1384.0
9 TraesCS6D01G065000 chr2A 94.767 879 40 3 1433 2306 490230626 490231503 0.000000e+00 1363.0
10 TraesCS6D01G065000 chr2A 94.881 879 33 5 1433 2306 496257925 496258796 0.000000e+00 1363.0
11 TraesCS6D01G065000 chr2A 94.653 879 41 3 1433 2306 457492394 457491517 0.000000e+00 1358.0
12 TraesCS6D01G065000 chr2A 96.044 733 17 4 1 727 490187410 490188136 0.000000e+00 1182.0
13 TraesCS6D01G065000 chr2A 96.159 729 18 3 1 723 496256236 496256960 0.000000e+00 1182.0
14 TraesCS6D01G065000 chr2A 95.498 733 22 4 1 727 490228937 490229664 0.000000e+00 1160.0
15 TraesCS6D01G065000 chr2A 94.966 735 27 3 711 1436 490229852 490230585 0.000000e+00 1144.0
16 TraesCS6D01G065000 chr2A 94.830 735 28 3 711 1436 490188324 490189057 0.000000e+00 1138.0
17 TraesCS6D01G065000 chr2A 94.422 735 31 3 711 1436 496257151 496257884 0.000000e+00 1122.0
18 TraesCS6D01G065000 chr2A 88.991 109 12 0 2303 2411 490189941 490190049 4.180000e-28 135.0
19 TraesCS6D01G065000 chr2A 88.991 109 11 1 2303 2411 457491550 457491443 1.500000e-27 134.0
20 TraesCS6D01G065000 chr2A 87.879 99 12 0 2313 2411 496258773 496258871 1.510000e-22 117.0
21 TraesCS6D01G065000 chr4A 95.630 961 29 6 486 1436 25596250 25595293 0.000000e+00 1530.0
22 TraesCS6D01G065000 chr4A 95.108 879 32 5 1433 2306 25595252 25594380 0.000000e+00 1375.0
23 TraesCS6D01G065000 chr4A 86.591 880 107 9 1431 2306 563550134 563549262 0.000000e+00 961.0
24 TraesCS6D01G065000 chr4A 95.723 491 12 3 3 488 25596817 25596331 0.000000e+00 782.0
25 TraesCS6D01G065000 chr4A 88.621 457 35 9 47 498 642608864 642609308 7.580000e-150 540.0
26 TraesCS6D01G065000 chr5D 86.462 879 106 11 1433 2306 154780068 154779198 0.000000e+00 952.0
27 TraesCS6D01G065000 chrUn 100.000 460 0 0 1 460 414719979 414719520 0.000000e+00 850.0
28 TraesCS6D01G065000 chrUn 94.737 57 2 1 1 57 333480652 333480707 1.190000e-13 87.9
29 TraesCS6D01G065000 chr7D 82.790 767 116 11 580 1333 32518711 32517948 0.000000e+00 671.0
30 TraesCS6D01G065000 chr7D 82.790 767 116 11 580 1333 625870180 625870943 0.000000e+00 671.0
31 TraesCS6D01G065000 chr2B 89.759 166 15 2 1272 1436 363508074 363508238 6.750000e-51 211.0
32 TraesCS6D01G065000 chr2D 89.147 129 12 2 1281 1408 298696719 298696592 2.480000e-35 159.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G065000 chr6D 31723986 31726396 2410 False 4453.000000 4453 100.00000 1 2411 1 chr6D.!!$F1 2410
1 TraesCS6D01G065000 chr6D 62079114 62079877 763 True 676.000000 676 82.92000 580 1333 1 chr6D.!!$R1 753
2 TraesCS6D01G065000 chr3D 367917073 367919483 2410 False 4331.000000 4331 99.08800 1 2411 1 chr3D.!!$F1 2410
3 TraesCS6D01G065000 chr3D 609175307 609177331 2024 False 891.500000 1040 90.28300 47 2306 2 chr3D.!!$F2 2259
4 TraesCS6D01G065000 chr5B 40316568 40317632 1064 False 1664.000000 1664 94.81000 1 1073 1 chr5B.!!$F2 1072
5 TraesCS6D01G065000 chr5B 40211286 40212350 1064 False 1653.000000 1653 94.62500 1 1073 1 chr5B.!!$F1 1072
6 TraesCS6D01G065000 chr2A 490228937 490231503 2566 False 1222.333333 1363 95.07700 1 2306 3 chr2A.!!$F2 2305
7 TraesCS6D01G065000 chr2A 457491443 457493472 2029 True 1032.333333 1605 92.79200 406 2411 3 chr2A.!!$R1 2005
8 TraesCS6D01G065000 chr2A 490187410 490190049 2639 False 959.750000 1384 93.77175 1 2411 4 chr2A.!!$F1 2410
9 TraesCS6D01G065000 chr2A 496256236 496258871 2635 False 946.000000 1363 93.33525 1 2411 4 chr2A.!!$F3 2410
10 TraesCS6D01G065000 chr4A 25594380 25596817 2437 True 1229.000000 1530 95.48700 3 2306 3 chr4A.!!$R2 2303
11 TraesCS6D01G065000 chr4A 563549262 563550134 872 True 961.000000 961 86.59100 1431 2306 1 chr4A.!!$R1 875
12 TraesCS6D01G065000 chr5D 154779198 154780068 870 True 952.000000 952 86.46200 1433 2306 1 chr5D.!!$R1 873
13 TraesCS6D01G065000 chr7D 32517948 32518711 763 True 671.000000 671 82.79000 580 1333 1 chr7D.!!$R1 753
14 TraesCS6D01G065000 chr7D 625870180 625870943 763 False 671.000000 671 82.79000 580 1333 1 chr7D.!!$F1 753

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
704 818 1.674441 CTCCGCAATGCAACTCATCAT 59.326 47.619 5.91 0.0 33.4 2.45 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1783 2472 3.315749 CCGTGGTCTAGAGTCCATTCTAC 59.684 52.174 5.44 0.0 35.8 2.59 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
575 689 2.651382 AAGGGCGAGGTGTACTTTTT 57.349 45.000 0.00 0.00 0.00 1.94
704 818 1.674441 CTCCGCAATGCAACTCATCAT 59.326 47.619 5.91 0.00 33.40 2.45
814 1334 8.697507 ACAACAGAGATCCAAAAGATAAACTT 57.302 30.769 0.00 0.00 40.98 2.66
1013 1538 5.291178 TGAGAAAAACATGATGGCAAAGTG 58.709 37.500 0.00 0.00 0.00 3.16
1318 1951 4.402155 AGCTTGGTTTGTCTTCATGTTGAA 59.598 37.500 0.00 0.00 34.79 2.69
1559 2244 4.534500 TGTTAATGGAGTGGTACATCAGGT 59.466 41.667 0.00 0.00 44.52 4.00
1627 2313 7.519008 GCAGAAAGGTACTATGCATGTATGAAC 60.519 40.741 10.16 2.02 40.66 3.18
1783 2472 7.104043 TCATTGCAGGATCCAAAGATTTAAG 57.896 36.000 15.82 0.00 30.90 1.85
1971 2664 9.685828 TGAATCATGTAATTGAATGCATGTATG 57.314 29.630 16.86 0.00 39.54 2.39
2096 2793 4.000988 CGACCTATTTTGTTGCACTAGGT 58.999 43.478 0.00 0.00 43.70 3.08
2263 2962 7.397892 TTTCACCACAAATGTCTTTCTGTTA 57.602 32.000 0.00 0.00 0.00 2.41
2323 3022 9.520204 CTGTAATTTATCACCACCAAAATGATC 57.480 33.333 0.00 0.00 34.86 2.92
2380 3079 2.289565 GTTGCCTTACATCACTAGGGC 58.710 52.381 0.00 0.00 38.96 5.19
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
704 818 4.140575 TGTATCCATACCCATGAGGCTA 57.859 45.455 0.00 0.00 40.58 3.93
814 1334 0.251354 GACCTGATGGCTGAGCTCAA 59.749 55.000 18.85 3.02 36.63 3.02
1522 2207 5.015515 TCCATTAACAATCAGGTGCAATGA 58.984 37.500 5.41 5.41 30.99 2.57
1783 2472 3.315749 CCGTGGTCTAGAGTCCATTCTAC 59.684 52.174 5.44 0.00 35.80 2.59
2096 2793 6.918892 ATATAAAGTGTAGCATCGCAACAA 57.081 33.333 0.00 0.00 0.00 2.83
2263 2962 8.415950 TTTTGGTGGTGATAAATAGTTGTCAT 57.584 30.769 5.65 0.00 37.24 3.06
2323 3022 8.609176 ACGTGGTAATACTAAAATTACAGCATG 58.391 33.333 8.52 0.00 41.92 4.06
2380 3079 6.035843 GTGGTAATAGTCAATTGTGGCAATG 58.964 40.000 5.13 0.00 0.00 2.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.