Multiple sequence alignment - TraesCS6D01G056500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G056500 chr6D 100.000 2732 0 0 1 2732 27044087 27046818 0 5046
1 TraesCS6D01G056500 chr6D 97.223 2737 67 5 1 2732 360363084 360360352 0 4625
2 TraesCS6D01G056500 chr6D 97.187 2737 67 6 1 2732 358574571 358577302 0 4619
3 TraesCS6D01G056500 chr5D 97.444 2739 60 6 1 2732 419654497 419657232 0 4662
4 TraesCS6D01G056500 chr5D 97.187 2737 67 6 1 2732 11045255 11047986 0 4619
5 TraesCS6D01G056500 chr5D 97.187 2737 67 6 1 2732 462673599 462676330 0 4619
6 TraesCS6D01G056500 chr3D 97.296 2737 63 6 1 2732 263740869 263743599 0 4634
7 TraesCS6D01G056500 chr3D 97.295 2736 63 4 1 2732 114741378 114738650 0 4632
8 TraesCS6D01G056500 chr3D 97.149 2736 67 4 1 2732 289473108 289470380 0 4610
9 TraesCS6D01G056500 chr1D 97.150 2737 69 5 1 2732 255453691 255456423 0 4614


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G056500 chr6D 27044087 27046818 2731 False 5046 5046 100.000 1 2732 1 chr6D.!!$F1 2731
1 TraesCS6D01G056500 chr6D 360360352 360363084 2732 True 4625 4625 97.223 1 2732 1 chr6D.!!$R1 2731
2 TraesCS6D01G056500 chr6D 358574571 358577302 2731 False 4619 4619 97.187 1 2732 1 chr6D.!!$F2 2731
3 TraesCS6D01G056500 chr5D 419654497 419657232 2735 False 4662 4662 97.444 1 2732 1 chr5D.!!$F2 2731
4 TraesCS6D01G056500 chr5D 11045255 11047986 2731 False 4619 4619 97.187 1 2732 1 chr5D.!!$F1 2731
5 TraesCS6D01G056500 chr5D 462673599 462676330 2731 False 4619 4619 97.187 1 2732 1 chr5D.!!$F3 2731
6 TraesCS6D01G056500 chr3D 263740869 263743599 2730 False 4634 4634 97.296 1 2732 1 chr3D.!!$F1 2731
7 TraesCS6D01G056500 chr3D 114738650 114741378 2728 True 4632 4632 97.295 1 2732 1 chr3D.!!$R1 2731
8 TraesCS6D01G056500 chr3D 289470380 289473108 2728 True 4610 4610 97.149 1 2732 1 chr3D.!!$R2 2731
9 TraesCS6D01G056500 chr1D 255453691 255456423 2732 False 4614 4614 97.150 1 2732 1 chr1D.!!$F1 2731

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
887 895 3.389329 ACCATTTGAGGTCTGATCGCTAT 59.611 43.478 0.0 0.0 37.28 2.97 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2041 2052 0.52847 CGGTGGGTTGTTGTTGTTGT 59.472 50.0 0.0 0.0 0.0 3.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
48 49 4.038642 GCTCTAGCATAGCTGAGTAGGTTT 59.961 45.833 0.00 0.00 40.10 3.27
324 325 8.512956 GGATTATCATTTGAATCTCATCACCAG 58.487 37.037 0.00 0.00 33.41 4.00
565 570 7.339212 TGTGTTACTTTGCCAGCATATTCTATT 59.661 33.333 0.00 0.00 0.00 1.73
778 786 9.871238 AGAGTTATTCGATGTAATAAGTGTGTT 57.129 29.630 0.69 0.00 35.88 3.32
887 895 3.389329 ACCATTTGAGGTCTGATCGCTAT 59.611 43.478 0.00 0.00 37.28 2.97
909 917 7.494625 GCTATAAAGTTGGTATTAGAGCACACA 59.505 37.037 7.14 0.00 42.79 3.72
1005 1014 7.394641 CCTTTTTCTACTCTTTTAGGAATGGCT 59.605 37.037 0.00 0.00 0.00 4.75
1120 1129 1.609580 GCATCACCGGAACCTACAACA 60.610 52.381 9.46 0.00 0.00 3.33
1135 1144 5.067273 CCTACAACACCACATTACCTGAAA 58.933 41.667 0.00 0.00 0.00 2.69
1156 1165 3.625649 AGGAGAGCTGGAAGATTCAAC 57.374 47.619 0.00 0.00 34.07 3.18
1305 1314 2.104963 CCACCAGGAGCTTAAGGATACC 59.895 54.545 4.29 0.00 36.89 2.73
1332 1341 2.492088 TCAGATTTGTGGACGTCGAGAT 59.508 45.455 9.92 0.13 0.00 2.75
1410 1419 3.197766 AGGAGCAGAACCAACATATTCGA 59.802 43.478 0.00 0.00 0.00 3.71
1671 1680 2.352814 CGACTCGGAACCAAGTGAAGAT 60.353 50.000 0.00 0.00 0.00 2.40
1676 1685 3.071023 TCGGAACCAAGTGAAGATGACTT 59.929 43.478 0.00 0.00 39.24 3.01
1677 1686 3.815401 CGGAACCAAGTGAAGATGACTTT 59.185 43.478 0.00 0.00 36.39 2.66
1759 1769 6.885922 ACCACCATATCAGTAGTAGTTTTCC 58.114 40.000 0.00 0.00 0.00 3.13
2016 2027 0.179119 GAATGCCCTGATGCAAGTGC 60.179 55.000 0.00 0.00 45.84 4.40
2039 2050 0.459489 TGCAGAACCAAGGCAACAAC 59.541 50.000 0.00 0.00 41.41 3.32
2040 2051 0.459489 GCAGAACCAAGGCAACAACA 59.541 50.000 0.00 0.00 41.41 3.33
2041 2052 1.134848 GCAGAACCAAGGCAACAACAA 60.135 47.619 0.00 0.00 41.41 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
48 49 3.102972 CCACCTCTTCAAGAGATCCTGA 58.897 50.000 16.64 0.00 45.07 3.86
359 360 4.462483 TCCAACTCAATCCCAATTAAGTGC 59.538 41.667 0.00 0.00 0.00 4.40
565 570 1.452145 GCCCGAAAACAGGTCAGCAA 61.452 55.000 0.00 0.00 0.00 3.91
574 579 1.658686 AACGTTGCAGCCCGAAAACA 61.659 50.000 0.00 0.00 0.00 2.83
778 786 8.304596 CGGAGGATTTATAACAGAGTAGCAATA 58.695 37.037 0.00 0.00 0.00 1.90
826 834 3.069300 CAGTGTCATCCCTGGATCAGTAG 59.931 52.174 0.00 0.00 31.62 2.57
880 888 7.599245 GTGCTCTAATACCAACTTTATAGCGAT 59.401 37.037 0.00 0.00 32.94 4.58
887 895 6.649141 CAGTGTGTGCTCTAATACCAACTTTA 59.351 38.462 0.00 0.00 0.00 1.85
909 917 1.245732 GGTCGTGTCCTACAGTCAGT 58.754 55.000 0.00 0.00 0.00 3.41
1120 1129 4.807643 GCTCTCCTTTTCAGGTAATGTGGT 60.808 45.833 0.00 0.00 41.69 4.16
1135 1144 3.586618 AGTTGAATCTTCCAGCTCTCCTT 59.413 43.478 0.00 0.00 0.00 3.36
1305 1314 5.290885 TCGACGTCCACAAATCTGATAAATG 59.709 40.000 10.58 0.00 0.00 2.32
1332 1341 0.180878 TGATCATCTCCCATTGCGCA 59.819 50.000 5.66 5.66 0.00 6.09
1410 1419 1.194781 ACATCTGGTTCTCCTGGCGT 61.195 55.000 0.00 0.00 34.13 5.68
1671 1680 3.817084 CTCCAGCTTCATCAACAAAGTCA 59.183 43.478 0.00 0.00 0.00 3.41
1676 1685 2.156917 CTGCTCCAGCTTCATCAACAA 58.843 47.619 0.00 0.00 42.66 2.83
1677 1686 1.348696 TCTGCTCCAGCTTCATCAACA 59.651 47.619 0.00 0.00 42.66 3.33
1759 1769 6.294731 GCTTGAACTATGCTATTAAATGGGGG 60.295 42.308 0.00 0.00 0.00 5.40
1773 1783 4.457810 CGTGACAAAGTGCTTGAACTATG 58.542 43.478 0.00 0.00 38.50 2.23
2016 2027 1.537202 GTTGCCTTGGTTCTGCACTAG 59.463 52.381 0.00 0.00 34.16 2.57
2039 2050 2.342179 GGTGGGTTGTTGTTGTTGTTG 58.658 47.619 0.00 0.00 0.00 3.33
2040 2051 1.067495 CGGTGGGTTGTTGTTGTTGTT 60.067 47.619 0.00 0.00 0.00 2.83
2041 2052 0.528470 CGGTGGGTTGTTGTTGTTGT 59.472 50.000 0.00 0.00 0.00 3.32
2139 2156 2.469274 CGGAGCCAATCATCTGCTAT 57.531 50.000 0.00 0.00 34.99 2.97
2523 2540 4.980573 TGGTAGTTGTTGAAGGTTGCTAT 58.019 39.130 0.00 0.00 0.00 2.97
2685 2702 3.630625 ACTACCTCCATGGGTATGCTA 57.369 47.619 13.02 0.00 40.56 3.49


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.