Multiple sequence alignment - TraesCS6D01G056100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G056100 chr6D 100.000 3185 0 0 1 3185 26817828 26814644 0.000000e+00 5882.0
1 TraesCS6D01G056100 chr6D 99.623 3186 11 1 1 3185 26897917 26894732 0.000000e+00 5816.0
2 TraesCS6D01G056100 chr6D 99.592 3186 12 1 1 3185 26861577 26858392 0.000000e+00 5810.0
3 TraesCS6D01G056100 chr6D 84.791 1749 226 21 614 2342 27033222 27031494 0.000000e+00 1720.0
4 TraesCS6D01G056100 chr6D 79.074 1663 287 39 661 2303 26515886 26517507 0.000000e+00 1086.0
5 TraesCS6D01G056100 chr6D 73.350 818 173 31 1007 1801 26601543 26600748 8.760000e-66 261.0
6 TraesCS6D01G056100 chr6D 81.481 189 28 6 661 848 26531870 26532052 7.120000e-32 148.0
7 TraesCS6D01G056100 chr6D 88.462 52 4 2 2775 2825 292309121 292309071 9.540000e-06 62.1
8 TraesCS6D01G056100 chr6A 94.148 2751 127 18 442 3185 28259106 28256383 0.000000e+00 4157.0
9 TraesCS6D01G056100 chr6A 85.754 1439 182 15 919 2342 28319311 28317881 0.000000e+00 1500.0
10 TraesCS6D01G056100 chr6A 83.573 834 117 12 1523 2342 28317297 28316470 0.000000e+00 763.0
11 TraesCS6D01G056100 chr6A 90.132 456 17 7 3 446 28260018 28259579 4.610000e-158 568.0
12 TraesCS6D01G056100 chr6B 93.908 2577 130 18 614 3185 49239124 49236570 0.000000e+00 3864.0
13 TraesCS6D01G056100 chr6B 95.670 1663 49 5 1083 2730 49052913 49051259 0.000000e+00 2651.0
14 TraesCS6D01G056100 chr6B 95.326 1305 31 10 879 2183 49551602 49552876 0.000000e+00 2045.0
15 TraesCS6D01G056100 chr6B 96.883 738 22 1 2448 3185 49552901 49553637 0.000000e+00 1234.0
16 TraesCS6D01G056100 chr6B 94.431 413 21 2 2773 3185 48981590 48981180 4.480000e-178 634.0
17 TraesCS6D01G056100 chr6B 93.705 413 23 3 2773 3185 48938524 48938115 1.620000e-172 616.0
18 TraesCS6D01G056100 chr6B 93.705 413 20 6 2773 3185 48874198 48873792 5.840000e-172 614.0
19 TraesCS6D01G056100 chr6B 90.020 491 21 5 621 1087 49066986 49066500 7.550000e-171 610.0
20 TraesCS6D01G056100 chr6B 95.299 234 11 0 622 855 49551047 49551280 3.880000e-99 372.0
21 TraesCS6D01G056100 chr6B 87.460 311 37 2 2032 2342 49235978 49235670 1.090000e-94 357.0
22 TraesCS6D01G056100 chr6B 90.840 262 20 2 595 855 49199855 49199597 6.540000e-92 348.0
23 TraesCS6D01G056100 chr6B 80.612 392 56 12 614 997 49236374 49235995 5.200000e-73 285.0
24 TraesCS6D01G056100 chr6B 100.000 40 0 0 855 894 49236107 49236068 1.230000e-09 75.0
25 TraesCS6D01G056100 chr6B 100.000 30 0 0 853 882 49551301 49551330 4.440000e-04 56.5
26 TraesCS6D01G056100 chr3D 80.282 213 32 9 62 268 593259942 593260150 5.500000e-33 152.0
27 TraesCS6D01G056100 chr3B 93.684 95 6 0 2840 2934 527240035 527239941 3.310000e-30 143.0
28 TraesCS6D01G056100 chr2B 93.590 78 5 0 301 378 462731676 462731599 2.010000e-22 117.0
29 TraesCS6D01G056100 chr2B 89.231 65 7 0 311 375 184912228 184912164 7.320000e-12 82.4
30 TraesCS6D01G056100 chr7B 81.132 106 17 2 273 377 102646776 102646673 7.320000e-12 82.4
31 TraesCS6D01G056100 chr7A 89.831 59 6 0 315 373 2820904 2820846 3.410000e-10 76.8
32 TraesCS6D01G056100 chr7D 88.235 68 0 7 337 397 358560610 358560544 1.230000e-09 75.0
33 TraesCS6D01G056100 chr4B 92.157 51 4 0 330 380 611234062 611234112 4.410000e-09 73.1
34 TraesCS6D01G056100 chr2D 100.000 38 0 0 63 100 485081661 485081698 1.590000e-08 71.3
35 TraesCS6D01G056100 chr5D 84.483 58 8 1 1502 1559 553759034 553759090 4.440000e-04 56.5
36 TraesCS6D01G056100 chr4A 84.483 58 8 1 1502 1559 614864357 614864301 4.440000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G056100 chr6D 26814644 26817828 3184 True 5882.000 5882 100.0000 1 3185 1 chr6D.!!$R2 3184
1 TraesCS6D01G056100 chr6D 26894732 26897917 3185 True 5816.000 5816 99.6230 1 3185 1 chr6D.!!$R4 3184
2 TraesCS6D01G056100 chr6D 26858392 26861577 3185 True 5810.000 5810 99.5920 1 3185 1 chr6D.!!$R3 3184
3 TraesCS6D01G056100 chr6D 27031494 27033222 1728 True 1720.000 1720 84.7910 614 2342 1 chr6D.!!$R5 1728
4 TraesCS6D01G056100 chr6D 26515886 26517507 1621 False 1086.000 1086 79.0740 661 2303 1 chr6D.!!$F1 1642
5 TraesCS6D01G056100 chr6D 26600748 26601543 795 True 261.000 261 73.3500 1007 1801 1 chr6D.!!$R1 794
6 TraesCS6D01G056100 chr6A 28256383 28260018 3635 True 2362.500 4157 92.1400 3 3185 2 chr6A.!!$R1 3182
7 TraesCS6D01G056100 chr6A 28316470 28319311 2841 True 1131.500 1500 84.6635 919 2342 2 chr6A.!!$R2 1423
8 TraesCS6D01G056100 chr6B 49051259 49052913 1654 True 2651.000 2651 95.6700 1083 2730 1 chr6B.!!$R4 1647
9 TraesCS6D01G056100 chr6B 49235670 49239124 3454 True 1145.250 3864 90.4950 614 3185 4 chr6B.!!$R7 2571
10 TraesCS6D01G056100 chr6B 49551047 49553637 2590 False 926.875 2045 96.8770 622 3185 4 chr6B.!!$F1 2563

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1736 2558 0.322975 CTACACTGGCTGCTTGGAGT 59.677 55.0 0.0 0.0 0.0 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2709 4034 0.183971 TTCAGGAAAACCAAGGCGGA 59.816 50.0 0.0 0.0 38.63 5.54 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1736 2558 0.322975 CTACACTGGCTGCTTGGAGT 59.677 55.000 0.0 0.0 0.0 3.85
2264 3088 5.937540 TGTCGTTCACATCCTTTCATGTTAT 59.062 36.000 0.0 0.0 34.6 1.89
2487 3409 6.262273 ACAACTGTAGTCCTGTGGTTTTATTG 59.738 38.462 0.0 0.0 0.0 1.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1736 2558 0.035439 GAGAATTCCAACCGAGCCCA 60.035 55.000 0.65 0.00 0.00 5.36
2487 3409 4.732672 AGAGTCGTTATACCCCTCAAAC 57.267 45.455 0.00 0.00 0.00 2.93
2709 4034 0.183971 TTCAGGAAAACCAAGGCGGA 59.816 50.000 0.00 0.00 38.63 5.54
3039 4506 2.203070 GATCCGCCGGCAGAACAT 60.203 61.111 28.98 5.43 0.00 2.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.