Multiple sequence alignment - TraesCS6D01G051100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G051100 chr6D 100.000 3236 0 0 1 3236 24428080 24431315 0.000000e+00 5976.0
1 TraesCS6D01G051100 chr6D 87.732 3228 311 42 1 3156 24300431 24297217 0.000000e+00 3688.0
2 TraesCS6D01G051100 chr6D 84.686 2279 307 24 990 3236 24390487 24392755 0.000000e+00 2237.0
3 TraesCS6D01G051100 chr6D 84.511 2279 311 24 990 3236 24348840 24346572 0.000000e+00 2215.0
4 TraesCS6D01G051100 chr6D 93.671 1422 87 3 1816 3236 24364541 24363122 0.000000e+00 2124.0
5 TraesCS6D01G051100 chr6D 88.978 1624 169 9 1540 3157 24335147 24333528 0.000000e+00 1999.0
6 TraesCS6D01G051100 chr6D 83.593 2121 300 27 1151 3235 24225992 24228100 0.000000e+00 1945.0
7 TraesCS6D01G051100 chr6D 88.030 802 66 13 933 1710 24365334 24364539 0.000000e+00 922.0
8 TraesCS6D01G051100 chr6D 85.149 808 93 8 983 1764 24402178 24402984 0.000000e+00 802.0
9 TraesCS6D01G051100 chr6D 83.922 821 88 22 990 1770 24358122 24357306 0.000000e+00 745.0
10 TraesCS6D01G051100 chr6D 95.862 290 11 1 650 938 24366170 24365881 4.890000e-128 468.0
11 TraesCS6D01G051100 chr6A 91.426 2321 175 15 933 3236 23023012 23025325 0.000000e+00 3162.0
12 TraesCS6D01G051100 chr6A 88.674 1704 185 7 1537 3235 23443511 23441811 0.000000e+00 2071.0
13 TraesCS6D01G051100 chr6A 83.152 2297 326 24 990 3232 22816008 22818297 0.000000e+00 2041.0
14 TraesCS6D01G051100 chr6A 82.985 2298 328 32 990 3235 22690877 22693163 0.000000e+00 2019.0
15 TraesCS6D01G051100 chr6A 85.424 542 31 16 437 938 23022171 23022704 1.330000e-143 520.0
16 TraesCS6D01G051100 chr6B 92.030 1606 121 7 1633 3236 39433620 39435220 0.000000e+00 2250.0
17 TraesCS6D01G051100 chr6B 83.970 2277 308 33 999 3235 39193199 39195458 0.000000e+00 2130.0
18 TraesCS6D01G051100 chr6B 93.074 693 36 6 960 1640 39431474 39432166 0.000000e+00 1003.0
19 TraesCS6D01G051100 chr6B 96.296 54 2 0 806 859 39430945 39430998 4.450000e-14 89.8
20 TraesCS6D01G051100 chr2B 90.521 211 20 0 3 213 656963342 656963132 2.460000e-71 279.0
21 TraesCS6D01G051100 chr5D 81.667 360 41 11 1 339 337713285 337712930 3.180000e-70 276.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G051100 chr6D 24428080 24431315 3235 False 5976.000000 5976 100.000 1 3236 1 chr6D.!!$F4 3235
1 TraesCS6D01G051100 chr6D 24297217 24300431 3214 True 3688.000000 3688 87.732 1 3156 1 chr6D.!!$R1 3155
2 TraesCS6D01G051100 chr6D 24390487 24392755 2268 False 2237.000000 2237 84.686 990 3236 1 chr6D.!!$F2 2246
3 TraesCS6D01G051100 chr6D 24346572 24348840 2268 True 2215.000000 2215 84.511 990 3236 1 chr6D.!!$R3 2246
4 TraesCS6D01G051100 chr6D 24333528 24335147 1619 True 1999.000000 1999 88.978 1540 3157 1 chr6D.!!$R2 1617
5 TraesCS6D01G051100 chr6D 24225992 24228100 2108 False 1945.000000 1945 83.593 1151 3235 1 chr6D.!!$F1 2084
6 TraesCS6D01G051100 chr6D 24363122 24366170 3048 True 1171.333333 2124 92.521 650 3236 3 chr6D.!!$R5 2586
7 TraesCS6D01G051100 chr6D 24402178 24402984 806 False 802.000000 802 85.149 983 1764 1 chr6D.!!$F3 781
8 TraesCS6D01G051100 chr6D 24357306 24358122 816 True 745.000000 745 83.922 990 1770 1 chr6D.!!$R4 780
9 TraesCS6D01G051100 chr6A 23441811 23443511 1700 True 2071.000000 2071 88.674 1537 3235 1 chr6A.!!$R1 1698
10 TraesCS6D01G051100 chr6A 22816008 22818297 2289 False 2041.000000 2041 83.152 990 3232 1 chr6A.!!$F2 2242
11 TraesCS6D01G051100 chr6A 22690877 22693163 2286 False 2019.000000 2019 82.985 990 3235 1 chr6A.!!$F1 2245
12 TraesCS6D01G051100 chr6A 23022171 23025325 3154 False 1841.000000 3162 88.425 437 3236 2 chr6A.!!$F3 2799
13 TraesCS6D01G051100 chr6B 39193199 39195458 2259 False 2130.000000 2130 83.970 999 3235 1 chr6B.!!$F1 2236
14 TraesCS6D01G051100 chr6B 39430945 39435220 4275 False 1114.266667 2250 93.800 806 3236 3 chr6B.!!$F2 2430

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
357 358 2.427812 GGGAACTCGGACTTTCTCTAGG 59.572 54.545 0.00 0.0 0.0 3.02 F
387 388 2.627945 CAAGATTTCGATCGGGGAACA 58.372 47.619 16.41 0.0 0.0 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2209 4627 1.149854 GACCCCGTCCAGGTTGTTT 59.850 57.895 0.0 0.0 37.88 2.83 R
2245 4663 3.446161 CCTCCAACATACCTAGACGTGAA 59.554 47.826 0.0 0.0 0.00 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
321 322 2.997897 AGAGAAGTTCCCGCCGCT 60.998 61.111 0.00 0.0 0.00 5.52
357 358 2.427812 GGGAACTCGGACTTTCTCTAGG 59.572 54.545 0.00 0.0 0.00 3.02
387 388 2.627945 CAAGATTTCGATCGGGGAACA 58.372 47.619 16.41 0.0 0.00 3.18
461 462 6.145535 CCTCTTTTGTAATTTGAGTGCTGTC 58.854 40.000 0.00 0.0 0.00 3.51
529 530 4.824537 GGGAAGGGAATCTATTTCTTCTGC 59.175 45.833 14.03 0.0 34.16 4.26
1398 2325 4.690748 CACAACAGATTCGACAAGGTACAT 59.309 41.667 0.00 0.0 0.00 2.29
1723 4138 5.881443 CCTGATTCTCTTCTGCTCTCAAATT 59.119 40.000 0.00 0.0 0.00 1.82
1835 4250 8.633561 CAAGTATCTATATATCTCGGGCAATGA 58.366 37.037 0.00 0.0 0.00 2.57
1902 4317 6.459298 CCATTGTGGAGCTTGATTTATCAGAC 60.459 42.308 0.00 0.0 40.96 3.51
1959 4374 6.497259 TGAAGAACCTATGTAAGTTGGAGAGT 59.503 38.462 0.00 0.0 0.00 3.24
2007 4422 4.021894 AGCGGGAGTATAGCAGAGTTATTG 60.022 45.833 0.00 0.0 0.00 1.90
2030 4445 4.671766 GCATCGATTACCAAACTGTTCACC 60.672 45.833 0.00 0.0 0.00 4.02
2209 4627 7.180408 AGCTAACAAATCTGGACCTTAGTTCTA 59.820 37.037 0.00 0.0 0.00 2.10
2244 4662 4.202315 CGGGGTCATACATGAAGGTCATTA 60.202 45.833 0.00 0.0 38.75 1.90
2245 4663 5.513094 CGGGGTCATACATGAAGGTCATTAT 60.513 44.000 0.00 0.0 38.75 1.28
2557 4978 7.066766 ACAATGGAATTTATGAGAGCAGAAGTC 59.933 37.037 0.00 0.0 31.22 3.01
2616 5037 4.971924 ACCTAAGCTTCCCATCACTCTAAT 59.028 41.667 0.00 0.0 0.00 1.73
2674 5095 4.323485 CCACTACCATTAGACTTTGGAGCA 60.323 45.833 10.29 0.0 36.79 4.26
2692 5113 1.960689 GCACCAGGGCTTGAAAAACTA 59.039 47.619 0.00 0.0 0.00 2.24
2798 5219 9.309516 CAAGAAATAACCTCAATGGATCAATTG 57.690 33.333 15.70 15.7 38.63 2.32
2825 5246 0.617413 CCCAGTCAATGAGTCCAGCT 59.383 55.000 0.00 0.0 0.00 4.24
2935 5363 5.047021 TCCACGACTCATCTTTCTTGATCTT 60.047 40.000 0.00 0.0 0.00 2.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
127 128 0.873312 CGTGGCTCGATCTGGTGATG 60.873 60.000 2.21 0.00 42.86 3.07
128 129 1.037579 TCGTGGCTCGATCTGGTGAT 61.038 55.000 7.67 0.00 44.01 3.06
129 130 1.677633 TCGTGGCTCGATCTGGTGA 60.678 57.895 7.67 0.00 44.01 4.02
296 297 0.615850 GGGAACTTCTCTCCCCACAG 59.384 60.000 0.00 0.00 46.18 3.66
335 336 2.312424 AGAGAAAGTCCGAGTTCCCT 57.688 50.000 0.00 0.00 0.00 4.20
357 358 5.266242 CGATCGAAATCTTGGGTTTTCATC 58.734 41.667 10.26 0.00 33.26 2.92
450 451 2.708216 TCACCAAAGACAGCACTCAA 57.292 45.000 0.00 0.00 0.00 3.02
461 462 1.808945 GCACTCTGACCATCACCAAAG 59.191 52.381 0.00 0.00 0.00 2.77
536 537 3.609853 TCCATCAAGAATACACACAGCC 58.390 45.455 0.00 0.00 0.00 4.85
1398 2325 3.775866 TGGAACCAATGAACTCCGGTATA 59.224 43.478 0.00 0.00 0.00 1.47
1535 2489 4.590647 AGGTGATATCAGTGGAGTATGTGG 59.409 45.833 5.42 0.00 0.00 4.17
1603 2557 1.959042 ACAAGTGTGCTGAGGTTCAG 58.041 50.000 1.75 1.75 46.90 3.02
1618 2572 2.486982 CAGATGGAAGCCAGTGAACAAG 59.513 50.000 0.00 0.00 36.75 3.16
1723 4138 4.745125 GTCGAGTGTTTCAAGAGATGTCAA 59.255 41.667 0.00 0.00 0.00 3.18
1835 4250 2.241176 TCTGGAAACGGGCCATAGAAAT 59.759 45.455 4.39 0.00 37.31 2.17
1902 4317 4.037923 GGTATCATGCCCACAAGGTTATTG 59.962 45.833 0.00 0.00 38.26 1.90
1959 4374 9.177608 CTGATATTGTTCCTGAAAGATACCAAA 57.822 33.333 0.00 0.00 34.07 3.28
2007 4422 4.403453 GTGAACAGTTTGGTAATCGATGC 58.597 43.478 0.00 0.00 0.00 3.91
2030 4445 6.622549 AGAGACAAGTCCTGTAGTTTATTCG 58.377 40.000 0.00 0.00 38.84 3.34
2209 4627 1.149854 GACCCCGTCCAGGTTGTTT 59.850 57.895 0.00 0.00 37.88 2.83
2244 4662 4.099573 CCTCCAACATACCTAGACGTGAAT 59.900 45.833 0.00 0.00 0.00 2.57
2245 4663 3.446161 CCTCCAACATACCTAGACGTGAA 59.554 47.826 0.00 0.00 0.00 3.18
2557 4978 4.946157 AGCTGGTTAGAACTGAAATCCATG 59.054 41.667 0.00 0.00 0.00 3.66
2674 5095 5.147767 AGAAATAGTTTTTCAAGCCCTGGT 58.852 37.500 8.50 0.00 0.00 4.00
2798 5219 1.404391 CTCATTGACTGGGCAATCAGC 59.596 52.381 0.00 0.00 44.65 4.26
2825 5246 4.276058 TGCTCAGATCTGTCATGTTTGA 57.724 40.909 21.92 0.00 0.00 2.69
2935 5363 4.689705 GCCCCAGAGAATTGATTATGTCCA 60.690 45.833 0.00 0.00 0.00 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.