Multiple sequence alignment - TraesCS6D01G045200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G045200 chr6D 100.000 2609 0 0 1 2609 20335036 20332428 0.000000e+00 4819
1 TraesCS6D01G045200 chr6A 94.787 2187 90 2 447 2609 173116466 173118652 0.000000e+00 3386
2 TraesCS6D01G045200 chr6A 93.722 446 18 2 1 446 173115961 173116396 0.000000e+00 660
3 TraesCS6D01G045200 chr6B 94.513 2187 95 7 447 2609 452164744 452166929 0.000000e+00 3350
4 TraesCS6D01G045200 chr2B 94.193 2187 82 5 447 2609 453172164 453174329 0.000000e+00 3293
5 TraesCS6D01G045200 chr2B 94.473 1375 52 9 1259 2609 5757419 5758793 0.000000e+00 2097
6 TraesCS6D01G045200 chr2B 94.395 446 21 1 1 446 453171653 453172094 0.000000e+00 682
7 TraesCS6D01G045200 chr2B 90.807 446 36 3 1 446 223065692 223065252 2.240000e-165 592
8 TraesCS6D01G045200 chr2B 94.400 125 7 0 448 572 223065181 223065057 2.650000e-45 193
9 TraesCS6D01G045200 chr7B 92.410 2187 141 10 447 2609 332533494 332535679 0.000000e+00 3096
10 TraesCS6D01G045200 chr7B 93.065 447 26 3 1 446 332532982 332533424 0.000000e+00 649
11 TraesCS6D01G045200 chr7D 95.455 1408 25 15 1226 2609 271291653 271293045 0.000000e+00 2209
12 TraesCS6D01G045200 chr7D 97.308 780 13 2 447 1226 271291060 271290289 0.000000e+00 1317
13 TraesCS6D01G045200 chr7D 97.085 446 9 1 1 446 271291571 271291130 0.000000e+00 749
14 TraesCS6D01G045200 chr5D 94.672 1389 50 8 1245 2609 153601091 153602479 0.000000e+00 2134
15 TraesCS6D01G045200 chr5D 96.373 772 26 2 447 1218 153600327 153601096 0.000000e+00 1269
16 TraesCS6D01G045200 chr5D 95.516 446 15 3 1 446 153599817 153600257 0.000000e+00 708
17 TraesCS6D01G045200 chr3B 96.863 510 16 0 2100 2609 720983379 720982870 0.000000e+00 854
18 TraesCS6D01G045200 chr3A 96.923 325 10 0 2285 2609 605022436 605022112 1.770000e-151 545


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G045200 chr6D 20332428 20335036 2608 True 4819.000000 4819 100.000000 1 2609 1 chr6D.!!$R1 2608
1 TraesCS6D01G045200 chr6A 173115961 173118652 2691 False 2023.000000 3386 94.254500 1 2609 2 chr6A.!!$F1 2608
2 TraesCS6D01G045200 chr6B 452164744 452166929 2185 False 3350.000000 3350 94.513000 447 2609 1 chr6B.!!$F1 2162
3 TraesCS6D01G045200 chr2B 5757419 5758793 1374 False 2097.000000 2097 94.473000 1259 2609 1 chr2B.!!$F1 1350
4 TraesCS6D01G045200 chr2B 453171653 453174329 2676 False 1987.500000 3293 94.294000 1 2609 2 chr2B.!!$F2 2608
5 TraesCS6D01G045200 chr2B 223065057 223065692 635 True 392.500000 592 92.603500 1 572 2 chr2B.!!$R1 571
6 TraesCS6D01G045200 chr7B 332532982 332535679 2697 False 1872.500000 3096 92.737500 1 2609 2 chr7B.!!$F1 2608
7 TraesCS6D01G045200 chr7D 271291653 271293045 1392 False 2209.000000 2209 95.455000 1226 2609 1 chr7D.!!$F1 1383
8 TraesCS6D01G045200 chr7D 271290289 271291571 1282 True 1033.000000 1317 97.196500 1 1226 2 chr7D.!!$R1 1225
9 TraesCS6D01G045200 chr5D 153599817 153602479 2662 False 1370.333333 2134 95.520333 1 2609 3 chr5D.!!$F1 2608
10 TraesCS6D01G045200 chr3B 720982870 720983379 509 True 854.000000 854 96.863000 2100 2609 1 chr3B.!!$R1 509

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
126 128 0.546747 TCACCCCGGTCCAAGATCTT 60.547 55.000 0.88 0.88 0.0 2.40 F
546 623 1.459450 GTCGTCTCTTCTCCTCTGCT 58.541 55.000 0.00 0.00 0.0 4.24 F
611 688 2.050077 GGTTTGCTTCCGCTGCAC 60.050 61.111 0.00 0.00 40.4 4.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1250 1327 0.105593 GATGCGATGAGGAGAAGGCA 59.894 55.0 0.00 0.0 34.6 4.75 R
1567 1644 0.252513 TGGTAGGCTGGGCTGAGTTA 60.253 55.0 6.93 0.0 0.0 2.24 R
2037 2138 1.489481 ATGCAATGACGGAGGAGAGA 58.511 50.0 0.00 0.0 0.0 3.10 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
126 128 0.546747 TCACCCCGGTCCAAGATCTT 60.547 55.000 0.88 0.88 0.00 2.40
280 288 4.335647 CTTCTGTGCCCGCCTGGT 62.336 66.667 0.00 0.00 36.04 4.00
546 623 1.459450 GTCGTCTCTTCTCCTCTGCT 58.541 55.000 0.00 0.00 0.00 4.24
611 688 2.050077 GGTTTGCTTCCGCTGCAC 60.050 61.111 0.00 0.00 40.40 4.57
746 823 2.190578 CATGTCCTTCCTCGGCCC 59.809 66.667 0.00 0.00 0.00 5.80
891 968 2.277949 CGCACCGATGTCGACGAT 60.278 61.111 11.62 5.64 43.02 3.73
1333 1410 3.068691 TCTCCTCCAAGGTCCGCG 61.069 66.667 0.00 0.00 36.53 6.46
2037 2138 3.087253 TCCCCGGCGTGGATGAAT 61.087 61.111 7.11 0.00 42.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
169 177 2.599597 GATGAGGTGCCCAGCCAT 59.400 61.111 0.00 0.00 0.00 4.40
170 178 4.100084 CGATGAGGTGCCCAGCCA 62.100 66.667 0.00 0.00 0.00 4.75
171 179 4.864334 CCGATGAGGTGCCCAGCC 62.864 72.222 0.00 0.00 34.51 4.85
173 181 3.746949 GAGCCGATGAGGTGCCCAG 62.747 68.421 0.00 0.00 43.70 4.45
174 182 3.785859 GAGCCGATGAGGTGCCCA 61.786 66.667 0.00 0.00 43.70 5.36
251 259 1.077930 ACAGAAGCGCAGATGGCAT 60.078 52.632 11.47 0.00 45.17 4.40
252 260 2.036571 CACAGAAGCGCAGATGGCA 61.037 57.895 11.47 0.00 45.17 4.92
253 261 2.789917 CACAGAAGCGCAGATGGC 59.210 61.111 11.47 0.00 39.90 4.40
254 262 2.758089 GGCACAGAAGCGCAGATGG 61.758 63.158 11.47 0.00 34.64 3.51
611 688 0.827368 GACCAGGTGGCTAGAAGAGG 59.173 60.000 0.00 0.00 39.32 3.69
664 741 2.530151 TGGAGGAGGGTGCTGCTT 60.530 61.111 0.00 0.00 0.00 3.91
821 898 4.147449 CGATGGCGGTGCTCTCCA 62.147 66.667 3.53 3.53 0.00 3.86
891 968 1.959226 GAACTTGCGGCGGAAGACA 60.959 57.895 40.82 14.10 41.50 3.41
1250 1327 0.105593 GATGCGATGAGGAGAAGGCA 59.894 55.000 0.00 0.00 34.60 4.75
1333 1410 2.519780 AGGGCGATCCTCCTCGAC 60.520 66.667 0.00 0.00 44.06 4.20
1567 1644 0.252513 TGGTAGGCTGGGCTGAGTTA 60.253 55.000 6.93 0.00 0.00 2.24
2037 2138 1.489481 ATGCAATGACGGAGGAGAGA 58.511 50.000 0.00 0.00 0.00 3.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.