Multiple sequence alignment - TraesCS6D01G038400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G038400 chr6D 100.000 4178 0 0 1 4178 16117058 16121235 0.000000e+00 7716
1 TraesCS6D01G038400 chr1A 97.376 2630 58 6 1 2626 176409715 176412337 0.000000e+00 4464
2 TraesCS6D01G038400 chr3A 97.224 2630 61 6 1 2626 296899490 296902111 0.000000e+00 4442
3 TraesCS6D01G038400 chr4B 94.831 2805 109 12 1 2800 149035778 149033005 0.000000e+00 4344
4 TraesCS6D01G038400 chr4B 94.652 2805 115 11 1 2800 148999554 148996780 0.000000e+00 4316
5 TraesCS6D01G038400 chr4B 92.849 881 52 7 3304 4178 414452074 414451199 0.000000e+00 1267
6 TraesCS6D01G038400 chr4B 91.497 882 40 17 3304 4178 149029735 149028882 0.000000e+00 1181
7 TraesCS6D01G038400 chr4B 91.383 882 41 17 3304 4178 148993520 148992667 0.000000e+00 1175
8 TraesCS6D01G038400 chr4B 95.844 385 11 2 1 384 421859705 421859325 5.930000e-173 617
9 TraesCS6D01G038400 chr1B 95.451 2704 102 14 619 3309 538915656 538918351 0.000000e+00 4292
10 TraesCS6D01G038400 chr1B 95.148 2700 111 13 619 3309 117567862 117570550 0.000000e+00 4242
11 TraesCS6D01G038400 chr1B 96.380 1105 29 8 2220 3314 192690476 192689373 0.000000e+00 1808
12 TraesCS6D01G038400 chr1B 91.932 880 42 9 3304 4178 192689281 192688426 0.000000e+00 1205
13 TraesCS6D01G038400 chrUn 95.568 2437 95 11 619 3046 286669929 286672361 0.000000e+00 3890
14 TraesCS6D01G038400 chrUn 95.568 2437 95 11 619 3046 286677286 286674854 0.000000e+00 3890
15 TraesCS6D01G038400 chrUn 96.408 1420 43 7 1633 3046 335064892 335063475 0.000000e+00 2333
16 TraesCS6D01G038400 chr7A 95.548 1460 50 14 1864 3314 629777745 629776292 0.000000e+00 2322
17 TraesCS6D01G038400 chr7A 96.687 1147 30 4 1 1144 629779791 629778650 0.000000e+00 1901
18 TraesCS6D01G038400 chr7A 97.111 727 21 0 1141 1867 629778593 629777867 0.000000e+00 1227
19 TraesCS6D01G038400 chr7A 94.774 708 31 4 3477 4178 629775758 629775051 0.000000e+00 1098
20 TraesCS6D01G038400 chr6B 94.070 1366 71 6 1 1363 328339248 328340606 0.000000e+00 2065
21 TraesCS6D01G038400 chr6B 96.530 1095 33 4 2220 3309 393761050 393762144 0.000000e+00 1807
22 TraesCS6D01G038400 chr6B 92.849 881 54 7 3304 4178 393762243 393763120 0.000000e+00 1269
23 TraesCS6D01G038400 chr3D 96.821 1101 28 6 2220 3314 256145692 256144593 0.000000e+00 1832
24 TraesCS6D01G038400 chr7D 91.329 1234 87 11 2088 3304 208818943 208817713 0.000000e+00 1668
25 TraesCS6D01G038400 chr3B 95.892 925 29 4 1 924 286888046 286887130 0.000000e+00 1489
26 TraesCS6D01G038400 chr3B 93.439 884 44 9 3304 4178 277659494 277660372 0.000000e+00 1299
27 TraesCS6D01G038400 chr3B 88.138 784 79 8 212 989 378723795 378723020 0.000000e+00 920
28 TraesCS6D01G038400 chr5D 94.677 883 35 8 3304 4178 249150433 249149555 0.000000e+00 1360
29 TraesCS6D01G038400 chr2B 94.098 881 34 8 3304 4178 220362434 220363302 0.000000e+00 1323
30 TraesCS6D01G038400 chr2B 93.190 881 48 9 3304 4178 421412489 421411615 0.000000e+00 1284
31 TraesCS6D01G038400 chr7B 88.265 784 78 8 212 989 141075808 141075033 0.000000e+00 926


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G038400 chr6D 16117058 16121235 4177 False 7716.0 7716 100.0000 1 4178 1 chr6D.!!$F1 4177
1 TraesCS6D01G038400 chr1A 176409715 176412337 2622 False 4464.0 4464 97.3760 1 2626 1 chr1A.!!$F1 2625
2 TraesCS6D01G038400 chr3A 296899490 296902111 2621 False 4442.0 4442 97.2240 1 2626 1 chr3A.!!$F1 2625
3 TraesCS6D01G038400 chr4B 149028882 149035778 6896 True 2762.5 4344 93.1640 1 4178 2 chr4B.!!$R4 4177
4 TraesCS6D01G038400 chr4B 148992667 148999554 6887 True 2745.5 4316 93.0175 1 4178 2 chr4B.!!$R3 4177
5 TraesCS6D01G038400 chr4B 414451199 414452074 875 True 1267.0 1267 92.8490 3304 4178 1 chr4B.!!$R1 874
6 TraesCS6D01G038400 chr1B 538915656 538918351 2695 False 4292.0 4292 95.4510 619 3309 1 chr1B.!!$F2 2690
7 TraesCS6D01G038400 chr1B 117567862 117570550 2688 False 4242.0 4242 95.1480 619 3309 1 chr1B.!!$F1 2690
8 TraesCS6D01G038400 chr1B 192688426 192690476 2050 True 1506.5 1808 94.1560 2220 4178 2 chr1B.!!$R1 1958
9 TraesCS6D01G038400 chrUn 286669929 286672361 2432 False 3890.0 3890 95.5680 619 3046 1 chrUn.!!$F1 2427
10 TraesCS6D01G038400 chrUn 286674854 286677286 2432 True 3890.0 3890 95.5680 619 3046 1 chrUn.!!$R1 2427
11 TraesCS6D01G038400 chrUn 335063475 335064892 1417 True 2333.0 2333 96.4080 1633 3046 1 chrUn.!!$R2 1413
12 TraesCS6D01G038400 chr7A 629775051 629779791 4740 True 1637.0 2322 96.0300 1 4178 4 chr7A.!!$R1 4177
13 TraesCS6D01G038400 chr6B 328339248 328340606 1358 False 2065.0 2065 94.0700 1 1363 1 chr6B.!!$F1 1362
14 TraesCS6D01G038400 chr6B 393761050 393763120 2070 False 1538.0 1807 94.6895 2220 4178 2 chr6B.!!$F2 1958
15 TraesCS6D01G038400 chr3D 256144593 256145692 1099 True 1832.0 1832 96.8210 2220 3314 1 chr3D.!!$R1 1094
16 TraesCS6D01G038400 chr7D 208817713 208818943 1230 True 1668.0 1668 91.3290 2088 3304 1 chr7D.!!$R1 1216
17 TraesCS6D01G038400 chr3B 286887130 286888046 916 True 1489.0 1489 95.8920 1 924 1 chr3B.!!$R1 923
18 TraesCS6D01G038400 chr3B 277659494 277660372 878 False 1299.0 1299 93.4390 3304 4178 1 chr3B.!!$F1 874
19 TraesCS6D01G038400 chr3B 378723020 378723795 775 True 920.0 920 88.1380 212 989 1 chr3B.!!$R2 777
20 TraesCS6D01G038400 chr5D 249149555 249150433 878 True 1360.0 1360 94.6770 3304 4178 1 chr5D.!!$R1 874
21 TraesCS6D01G038400 chr2B 220362434 220363302 868 False 1323.0 1323 94.0980 3304 4178 1 chr2B.!!$F1 874
22 TraesCS6D01G038400 chr2B 421411615 421412489 874 True 1284.0 1284 93.1900 3304 4178 1 chr2B.!!$R1 874
23 TraesCS6D01G038400 chr7B 141075033 141075808 775 True 926.0 926 88.2650 212 989 1 chr7B.!!$R1 777

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
662 668 3.074412 GGTTGTCACCATTAGGACACAG 58.926 50.0 0.0 0.0 43.22 3.66 F
1424 1498 2.185004 AACACCTTGGTCCAGATTCG 57.815 50.0 0.0 0.0 0.00 3.34 F
2499 2712 0.250901 AGCTGAATTGTGCTCCGGTT 60.251 50.0 0.0 0.0 33.90 4.44 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2368 2572 0.901827 TGACGCTTAGAGCAATGGGA 59.098 50.000 0.5 0.0 42.58 4.37 R
3048 5938 6.375455 AGACAAACATCAGTATTAAGCAAGGG 59.625 38.462 0.0 0.0 0.00 3.95 R
4025 7338 2.161410 GTGGATGTCAAATGCTTGCGTA 59.839 45.455 0.0 0.0 32.14 4.42 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
237 238 8.969121 TTGTTTAACTACAATCTGATGCAATG 57.031 30.769 0.00 0.00 33.31 2.82
662 668 3.074412 GGTTGTCACCATTAGGACACAG 58.926 50.000 0.00 0.00 43.22 3.66
1424 1498 2.185004 AACACCTTGGTCCAGATTCG 57.815 50.000 0.00 0.00 0.00 3.34
1764 1841 7.435488 ACTGTCAATTATGTTACGACATAGAGC 59.565 37.037 0.00 0.00 46.41 4.09
2396 2602 1.517257 CTAAGCGTCAGCCTGTCGG 60.517 63.158 12.95 0.00 46.67 4.79
2499 2712 0.250901 AGCTGAATTGTGCTCCGGTT 60.251 50.000 0.00 0.00 33.90 4.44
2656 2872 2.573369 GCATGAGAATGGTCTGCATCT 58.427 47.619 0.00 0.00 32.80 2.90
2716 2934 1.156736 ATAACTGTCAGCACAACGGC 58.843 50.000 0.00 0.00 29.82 5.68
2851 5738 7.495934 ACTTTCAGATATGTAAAATCCAGGACG 59.504 37.037 0.00 0.00 0.00 4.79
2935 5824 9.014297 TCTCGAACTTATTATATCATGCTCTCA 57.986 33.333 0.00 0.00 0.00 3.27
3517 6812 5.217400 AGAAATCCGAGGTAATAGGAAGGT 58.783 41.667 0.00 0.00 36.15 3.50
3618 6921 6.831769 TGCGTGAGAAGTTATTCTTTTCATC 58.168 36.000 4.61 2.24 45.98 2.92
3977 7285 6.037786 TCTCCTACCAAACTAAGATGTGTG 57.962 41.667 0.00 0.00 0.00 3.82
3998 7307 4.152938 GTGTTTACATCGTTTGTCCCTACC 59.847 45.833 0.00 0.00 39.87 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
228 229 5.255687 ACAATACAGAACTCCATTGCATCA 58.744 37.500 0.00 0.00 32.76 3.07
237 238 6.981559 GGACTATGAGAACAATACAGAACTCC 59.018 42.308 0.00 0.00 0.00 3.85
356 362 7.941431 TGACCTAAAACTGTAAAACAAGGAA 57.059 32.000 2.55 0.00 28.49 3.36
358 364 8.248253 ACTTTGACCTAAAACTGTAAAACAAGG 58.752 33.333 0.00 0.00 29.70 3.61
764 771 3.466836 TCCAAGATAATACGCCTGCAAG 58.533 45.455 0.00 0.00 0.00 4.01
1022 1035 3.672295 CTTCCTCTCGTGCCAGCCC 62.672 68.421 0.00 0.00 0.00 5.19
1023 1036 2.125350 CTTCCTCTCGTGCCAGCC 60.125 66.667 0.00 0.00 0.00 4.85
1025 1038 0.179089 CATCCTTCCTCTCGTGCCAG 60.179 60.000 0.00 0.00 0.00 4.85
1764 1841 8.044060 TCTGTAATTCCTAGTGAAAATTGCAG 57.956 34.615 18.44 18.44 46.01 4.41
1862 1939 6.600427 CGGGTTAGGAACACCAAATTTAGTAT 59.400 38.462 0.00 0.00 35.80 2.12
2368 2572 0.901827 TGACGCTTAGAGCAATGGGA 59.098 50.000 0.50 0.00 42.58 4.37
2499 2712 7.282224 ACAAAAATGCTACACTCTAACACTTCA 59.718 33.333 0.00 0.00 0.00 3.02
2716 2934 7.491696 CGGGAGTAACTTTCTATTGGTTAGAAG 59.508 40.741 0.00 0.00 45.40 2.85
2851 5738 7.678947 AGATATTGAAGGCACATTACATAGC 57.321 36.000 0.00 0.00 0.00 2.97
3048 5938 6.375455 AGACAAACATCAGTATTAAGCAAGGG 59.625 38.462 0.00 0.00 0.00 3.95
3445 6465 7.156673 CCAAATGACAGAGTCCAATTTGAATT 58.843 34.615 17.46 0.00 37.75 2.17
3517 6812 6.174720 ACTGTGAAACTGGTGAGATTTCTA 57.825 37.500 0.00 0.00 40.44 2.10
3774 7078 6.905578 AGTTTAAATCATCCCGTGTTGTAAC 58.094 36.000 0.00 0.00 0.00 2.50
3944 7252 4.164413 AGTTTGGTAGGAGAAAGCCCTATC 59.836 45.833 0.00 0.00 38.43 2.08
3977 7285 4.317488 TGGTAGGGACAAACGATGTAAAC 58.683 43.478 0.00 0.00 44.12 2.01
4025 7338 2.161410 GTGGATGTCAAATGCTTGCGTA 59.839 45.455 0.00 0.00 32.14 4.42


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.