Multiple sequence alignment - TraesCS6D01G025400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G025400 chr6D 100.000 2888 0 0 1 2888 9792513 9795400 0.000000e+00 5334.0
1 TraesCS6D01G025400 chr6D 96.346 2901 86 4 1 2885 9586911 9589807 0.000000e+00 4752.0
2 TraesCS6D01G025400 chr6D 78.857 175 37 0 1119 1293 9588617 9588791 5.060000e-23 119.0
3 TraesCS6D01G025400 chr6A 96.036 2901 93 7 1 2888 10917614 10920505 0.000000e+00 4700.0
4 TraesCS6D01G025400 chr6A 95.813 2890 114 6 1 2886 10516469 10519355 0.000000e+00 4660.0
5 TraesCS6D01G025400 chr6A 95.675 2890 119 5 1 2886 10559031 10561918 0.000000e+00 4639.0
6 TraesCS6D01G025400 chr6A 95.883 2283 93 1 1 2282 10600166 10602448 0.000000e+00 3694.0
7 TraesCS6D01G025400 chr6A 95.537 605 23 3 2281 2884 10609521 10610122 0.000000e+00 965.0
8 TraesCS6D01G025400 chr6A 94.357 319 16 2 2504 2821 588602430 588602113 3.340000e-134 488.0
9 TraesCS6D01G025400 chr6B 92.950 2298 108 15 1 2277 17532841 17535105 0.000000e+00 3297.0
10 TraesCS6D01G025400 chr6B 91.647 2167 147 14 132 2277 17704939 17702786 0.000000e+00 2968.0
11 TraesCS6D01G025400 chr6B 94.059 1498 68 2 738 2214 17685747 17687244 0.000000e+00 2254.0
12 TraesCS6D01G025400 chr6B 94.059 202 8 3 2309 2506 17687246 17687447 1.300000e-78 303.0
13 TraesCS6D01G025400 chr6B 87.983 233 18 5 2017 2243 17535067 17535295 1.710000e-67 267.0
14 TraesCS6D01G025400 chr6B 76.978 417 89 6 1120 1532 17686326 17686739 6.220000e-57 231.0
15 TraesCS6D01G025400 chr6B 80.328 244 46 2 1551 1793 17703908 17703666 1.770000e-42 183.0
16 TraesCS6D01G025400 chr6B 100.000 29 0 0 2293 2321 17535039 17535067 1.000000e-03 54.7
17 TraesCS6D01G025400 chr6B 100.000 29 0 0 2293 2321 17702852 17702824 1.000000e-03 54.7
18 TraesCS6D01G025400 chr5A 94.921 315 16 0 2500 2814 549204648 549204334 7.190000e-136 494.0
19 TraesCS6D01G025400 chr7D 95.440 307 13 1 2505 2811 539381773 539382078 3.340000e-134 488.0
20 TraesCS6D01G025400 chr7D 93.730 319 19 1 2505 2822 265508076 265507758 7.240000e-131 477.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G025400 chr6D 9792513 9795400 2887 False 5334.000000 5334 100.000000 1 2888 1 chr6D.!!$F1 2887
1 TraesCS6D01G025400 chr6D 9586911 9589807 2896 False 2435.500000 4752 87.601500 1 2885 2 chr6D.!!$F2 2884
2 TraesCS6D01G025400 chr6A 10917614 10920505 2891 False 4700.000000 4700 96.036000 1 2888 1 chr6A.!!$F5 2887
3 TraesCS6D01G025400 chr6A 10516469 10519355 2886 False 4660.000000 4660 95.813000 1 2886 1 chr6A.!!$F1 2885
4 TraesCS6D01G025400 chr6A 10559031 10561918 2887 False 4639.000000 4639 95.675000 1 2886 1 chr6A.!!$F2 2885
5 TraesCS6D01G025400 chr6A 10600166 10602448 2282 False 3694.000000 3694 95.883000 1 2282 1 chr6A.!!$F3 2281
6 TraesCS6D01G025400 chr6A 10609521 10610122 601 False 965.000000 965 95.537000 2281 2884 1 chr6A.!!$F4 603
7 TraesCS6D01G025400 chr6B 17532841 17535295 2454 False 1206.233333 3297 93.644333 1 2321 3 chr6B.!!$F1 2320
8 TraesCS6D01G025400 chr6B 17702786 17704939 2153 True 1068.566667 2968 90.658333 132 2321 3 chr6B.!!$R1 2189
9 TraesCS6D01G025400 chr6B 17685747 17687447 1700 False 929.333333 2254 88.365333 738 2506 3 chr6B.!!$F2 1768

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
149 150 0.530650 ATGGCACCTAATCGTCTGCG 60.531 55.0 0.00 0.0 39.92 5.18 F
557 560 0.892063 TACGCATGCACCTACAGTCA 59.108 50.0 19.57 0.0 0.00 3.41 F
1492 1495 0.324614 TGCCATCTCTCGGAAAGCAA 59.675 50.0 0.00 0.0 34.54 3.91 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1420 1423 2.437359 GTCTCGCTTGGCAGCCAT 60.437 61.111 17.09 0.0 44.06 4.40 R
1541 1544 3.138884 TGGTGAACATCTTAGCAGCAA 57.861 42.857 0.00 0.0 36.03 3.91 R
2488 2686 5.070580 AGGAGGCCTTGACATATACAGTAAC 59.929 44.000 6.77 0.0 0.00 2.50 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
149 150 0.530650 ATGGCACCTAATCGTCTGCG 60.531 55.000 0.00 0.0 39.92 5.18
206 208 4.803613 GGCGTGAGTTTGAAACTTTGAATT 59.196 37.500 12.37 0.0 43.03 2.17
557 560 0.892063 TACGCATGCACCTACAGTCA 59.108 50.000 19.57 0.0 0.00 3.41
559 562 1.480545 ACGCATGCACCTACAGTCATA 59.519 47.619 19.57 0.0 0.00 2.15
681 684 7.612677 ACCTACAACAATCTCGAAAAGAGTAT 58.387 34.615 0.00 0.0 46.86 2.12
931 934 7.432148 TTGTCTCTATAAAAGCCTATCACCA 57.568 36.000 0.00 0.0 0.00 4.17
982 985 1.213013 CTCCGCGCGCCTAAGATAT 59.787 57.895 27.36 0.0 0.00 1.63
1049 1052 4.782019 TGTTATTTCTCACCACCATTGC 57.218 40.909 0.00 0.0 0.00 3.56
1420 1423 1.108727 CAAGACACCTGCAAAGGCCA 61.109 55.000 5.01 0.0 40.13 5.36
1492 1495 0.324614 TGCCATCTCTCGGAAAGCAA 59.675 50.000 0.00 0.0 34.54 3.91
1496 1499 1.396301 CATCTCTCGGAAAGCAACTGC 59.604 52.381 0.00 0.0 42.49 4.40
1541 1544 0.846693 AGGAAAGAAGGCACCACTGT 59.153 50.000 0.00 0.0 0.00 3.55
1566 1590 4.216257 GCTGCTAAGATGTTCACCAAGAAA 59.784 41.667 0.00 0.0 38.13 2.52
2488 2686 0.677731 ACCGCCTCAATGTCACATGG 60.678 55.000 0.00 0.0 0.00 3.66
2613 2813 3.397527 AGGAATAGGAAAGGAGATGCCA 58.602 45.455 0.00 0.0 40.02 4.92
2628 2828 5.258456 AGATGCCATTTGATTCACATCAC 57.742 39.130 13.54 0.0 39.28 3.06
2633 2833 4.098960 GCCATTTGATTCACATCACAGGAT 59.901 41.667 0.00 0.0 39.28 3.24
2634 2834 5.394883 GCCATTTGATTCACATCACAGGATT 60.395 40.000 0.00 0.0 39.28 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
149 150 2.924290 GTGAGCCACGACTTAGATGAAC 59.076 50.000 0.00 0.00 0.00 3.18
206 208 4.191544 CAAATCTTTAGGCCATGACTCGA 58.808 43.478 5.01 0.00 0.00 4.04
557 560 0.744874 CTCCGACGGACACCATGTAT 59.255 55.000 13.88 0.00 0.00 2.29
559 562 1.469335 AACTCCGACGGACACCATGT 61.469 55.000 13.88 5.35 0.00 3.21
681 684 4.908601 TGCTCTTGAAATCCAGGACTTA 57.091 40.909 0.00 0.00 0.00 2.24
819 822 1.133976 CAGAGCCCCAGAAAGGTATGG 60.134 57.143 0.00 0.00 35.75 2.74
854 857 4.065088 TGAGGTCATAAGCTGTCAACAAC 58.935 43.478 0.00 0.00 32.07 3.32
982 985 6.480763 TGGCCATTAGTAATTTCTCAAGTGA 58.519 36.000 0.00 0.00 0.00 3.41
1420 1423 2.437359 GTCTCGCTTGGCAGCCAT 60.437 61.111 17.09 0.00 44.06 4.40
1492 1495 4.221041 GGAGGTAGAAGAACTTGTAGCAGT 59.779 45.833 18.13 3.99 38.69 4.40
1496 1499 3.451540 GGGGGAGGTAGAAGAACTTGTAG 59.548 52.174 0.00 0.00 0.00 2.74
1541 1544 3.138884 TGGTGAACATCTTAGCAGCAA 57.861 42.857 0.00 0.00 36.03 3.91
2488 2686 5.070580 AGGAGGCCTTGACATATACAGTAAC 59.929 44.000 6.77 0.00 0.00 2.50
2545 2745 7.623630 TGTCATCTCATTTCCTATGACTTTCA 58.376 34.615 13.59 0.00 45.40 2.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.