Multiple sequence alignment - TraesCS6D01G019500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G019500 chr6D 100.000 3155 0 0 1 3155 7884749 7887903 0.000000e+00 5827.0
1 TraesCS6D01G019500 chr6D 98.234 1189 7 2 1 1177 7873177 7874363 0.000000e+00 2067.0
2 TraesCS6D01G019500 chr6D 87.818 1732 156 34 721 2418 7961601 7963311 0.000000e+00 1978.0
3 TraesCS6D01G019500 chr6D 91.774 389 5 10 703 1090 7694785 7695147 1.680000e-142 516.0
4 TraesCS6D01G019500 chr6D 93.003 343 18 5 23 364 7906825 7907162 2.190000e-136 496.0
5 TraesCS6D01G019500 chr6D 90.493 284 22 1 2077 2360 7414889 7414611 1.380000e-98 370.0
6 TraesCS6D01G019500 chr6D 90.148 203 15 2 359 556 7961230 7961432 3.120000e-65 259.0
7 TraesCS6D01G019500 chr6D 96.667 150 4 1 559 708 7694541 7694689 6.760000e-62 248.0
8 TraesCS6D01G019500 chr6D 87.324 71 9 0 2884 2954 8655047 8654977 7.250000e-12 82.4
9 TraesCS6D01G019500 chr6D 97.222 36 1 0 840 875 7678645 7678680 9.450000e-06 62.1
10 TraesCS6D01G019500 chr6A 94.935 2468 89 19 703 3155 8170192 8172638 0.000000e+00 3832.0
11 TraesCS6D01G019500 chr6A 93.484 706 38 7 1 704 8169393 8170092 0.000000e+00 1042.0
12 TraesCS6D01G019500 chr6A 79.365 126 23 3 584 707 359022514 359022638 5.610000e-13 86.1
13 TraesCS6D01G019500 chr6B 92.857 1918 104 13 937 2840 14399924 14398026 0.000000e+00 2752.0
14 TraesCS6D01G019500 chr6B 86.478 1553 171 19 832 2360 13934254 13932717 0.000000e+00 1668.0
15 TraesCS6D01G019500 chr6B 87.660 1410 145 15 968 2358 14311087 14312486 0.000000e+00 1613.0
16 TraesCS6D01G019500 chr6B 86.066 1342 149 21 841 2163 54422413 54421091 0.000000e+00 1408.0
17 TraesCS6D01G019500 chr6B 85.609 1216 150 16 968 2163 14303255 14304465 0.000000e+00 1253.0
18 TraesCS6D01G019500 chr6B 83.773 1288 177 27 968 2232 14455067 14453789 0.000000e+00 1192.0
19 TraesCS6D01G019500 chr6B 91.972 710 41 11 1 707 14403504 14402808 0.000000e+00 981.0
20 TraesCS6D01G019500 chr6B 78.754 1332 235 37 970 2272 21458678 21459990 0.000000e+00 848.0
21 TraesCS6D01G019500 chr6B 85.390 616 74 10 2359 2960 14312579 14313192 2.670000e-175 625.0
22 TraesCS6D01G019500 chr6B 80.749 774 114 29 2359 3110 13932626 13931866 3.530000e-159 571.0
23 TraesCS6D01G019500 chr6B 92.308 221 7 7 703 922 14402702 14402491 3.950000e-79 305.0
24 TraesCS6D01G019500 chr3B 84.552 1463 194 21 970 2418 761047769 761046325 0.000000e+00 1421.0
25 TraesCS6D01G019500 chr3B 79.528 127 21 5 584 707 365282484 365282608 5.610000e-13 86.1
26 TraesCS6D01G019500 chr3B 78.571 126 24 3 584 707 420423382 420423506 2.610000e-11 80.5
27 TraesCS6D01G019500 chr4A 85.904 1206 158 9 968 2163 667380013 667381216 0.000000e+00 1275.0
28 TraesCS6D01G019500 chr4A 79.339 121 22 3 589 707 706590365 706590246 7.250000e-12 82.4
29 TraesCS6D01G019500 chr2B 78.571 126 24 3 584 707 741363512 741363636 2.610000e-11 80.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G019500 chr6D 7884749 7887903 3154 False 5827.0 5827 100.0000 1 3155 1 chr6D.!!$F3 3154
1 TraesCS6D01G019500 chr6D 7873177 7874363 1186 False 2067.0 2067 98.2340 1 1177 1 chr6D.!!$F2 1176
2 TraesCS6D01G019500 chr6D 7961230 7963311 2081 False 1118.5 1978 88.9830 359 2418 2 chr6D.!!$F6 2059
3 TraesCS6D01G019500 chr6D 7694541 7695147 606 False 382.0 516 94.2205 559 1090 2 chr6D.!!$F5 531
4 TraesCS6D01G019500 chr6A 8169393 8172638 3245 False 2437.0 3832 94.2095 1 3155 2 chr6A.!!$F2 3154
5 TraesCS6D01G019500 chr6B 54421091 54422413 1322 True 1408.0 1408 86.0660 841 2163 1 chr6B.!!$R2 1322
6 TraesCS6D01G019500 chr6B 14398026 14403504 5478 True 1346.0 2752 92.3790 1 2840 3 chr6B.!!$R4 2839
7 TraesCS6D01G019500 chr6B 14303255 14304465 1210 False 1253.0 1253 85.6090 968 2163 1 chr6B.!!$F1 1195
8 TraesCS6D01G019500 chr6B 14453789 14455067 1278 True 1192.0 1192 83.7730 968 2232 1 chr6B.!!$R1 1264
9 TraesCS6D01G019500 chr6B 13931866 13934254 2388 True 1119.5 1668 83.6135 832 3110 2 chr6B.!!$R3 2278
10 TraesCS6D01G019500 chr6B 14311087 14313192 2105 False 1119.0 1613 86.5250 968 2960 2 chr6B.!!$F3 1992
11 TraesCS6D01G019500 chr6B 21458678 21459990 1312 False 848.0 848 78.7540 970 2272 1 chr6B.!!$F2 1302
12 TraesCS6D01G019500 chr3B 761046325 761047769 1444 True 1421.0 1421 84.5520 970 2418 1 chr3B.!!$R1 1448
13 TraesCS6D01G019500 chr4A 667380013 667381216 1203 False 1275.0 1275 85.9040 968 2163 1 chr4A.!!$F1 1195

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
547 555 0.248012 ATGTTGTGGTGGCGTCGATA 59.752 50.0 0.0 0.0 0.0 2.92 F
1084 3836 0.628522 CCCACTCCTCTCTCTCTCCA 59.371 60.0 0.0 0.0 0.0 3.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1499 4269 0.543174 AGAGCGGAGGAAGAAGTGGT 60.543 55.000 0.0 0.0 0.0 4.16 R
2497 5386 1.973281 CCATCGGTGCAAGCCAACT 60.973 57.895 0.0 0.0 0.0 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
547 555 0.248012 ATGTTGTGGTGGCGTCGATA 59.752 50.000 0.00 0.00 0.00 2.92
579 587 7.769970 TGGGTAACTCGTCTTTTTAAAAGAAGA 59.230 33.333 25.71 25.71 34.51 2.87
1081 3833 0.926293 CTCCCCACTCCTCTCTCTCT 59.074 60.000 0.00 0.00 0.00 3.10
1082 3834 0.923358 TCCCCACTCCTCTCTCTCTC 59.077 60.000 0.00 0.00 0.00 3.20
1084 3836 0.628522 CCCACTCCTCTCTCTCTCCA 59.371 60.000 0.00 0.00 0.00 3.86
1247 4017 2.440430 CCTCTCCTTCCTCGCCGA 60.440 66.667 0.00 0.00 0.00 5.54
1307 4077 2.757099 GGACCCGCGGTTCCTCTA 60.757 66.667 32.45 0.00 35.25 2.43
1429 4199 2.563050 CTTCCGCTGCAGATCCGTCA 62.563 60.000 20.43 0.00 0.00 4.35
1499 4269 2.745884 CCGGCCGCTCAAACATGA 60.746 61.111 22.85 0.00 0.00 3.07
1609 4379 1.671850 CCAAGCTGTTCATCCGTACGT 60.672 52.381 15.21 0.00 0.00 3.57
1626 4396 0.807667 CGTCAAGGATGCTTAGCGCT 60.808 55.000 17.26 17.26 40.11 5.92
2445 5333 1.929836 GAACTAAGTGAGAGCATGCCG 59.070 52.381 15.66 0.00 0.00 5.69
2497 5386 2.708216 TCTAATGCATTCTGGGCGAA 57.292 45.000 16.86 0.00 35.78 4.70
2918 5811 4.202010 GCTTTGTTTCAGTGTTCTTGCCTA 60.202 41.667 0.00 0.00 0.00 3.93
2937 5830 4.141287 CCTAACAAGATGTTGGTTGTCCA 58.859 43.478 7.59 0.00 41.30 4.02
2963 5856 2.270923 GTATGTCTGTCGCATGCAAGA 58.729 47.619 19.57 14.07 0.00 3.02
3002 5926 4.344968 TCCTCATATGTCCGTGTCATCATT 59.655 41.667 1.90 0.00 0.00 2.57
3003 5927 5.059161 CCTCATATGTCCGTGTCATCATTT 58.941 41.667 1.90 0.00 0.00 2.32
3004 5928 5.528690 CCTCATATGTCCGTGTCATCATTTT 59.471 40.000 1.90 0.00 0.00 1.82
3150 6076 7.011763 GTGTGAGCTGAATATCTTCTTTATGCA 59.988 37.037 0.00 0.00 32.29 3.96
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
547 555 5.541953 AAAAGACGAGTTACCCAGTTAGT 57.458 39.130 0.00 0.00 0.00 2.24
579 587 9.319143 GATATAAATAAAGCTAGCCATGACGAT 57.681 33.333 12.13 0.80 0.00 3.73
1234 4004 2.754658 GAGGTCGGCGAGGAAGGA 60.755 66.667 11.20 0.00 0.00 3.36
1499 4269 0.543174 AGAGCGGAGGAAGAAGTGGT 60.543 55.000 0.00 0.00 0.00 4.16
1544 4314 1.548269 ACTCTGCTAGGAGCTTGACAC 59.452 52.381 6.35 0.00 42.97 3.67
1626 4396 3.894832 AGGACACGCCCTGGTTTA 58.105 55.556 0.00 0.00 37.37 2.01
1691 4461 0.804364 CAGCGCTTGCCTGAACATTA 59.196 50.000 7.50 0.00 40.41 1.90
2479 5368 2.292267 ACTTCGCCCAGAATGCATTAG 58.708 47.619 12.97 8.13 38.34 1.73
2497 5386 1.973281 CCATCGGTGCAAGCCAACT 60.973 57.895 0.00 0.00 0.00 3.16
2529 5419 2.300152 GTCTGAACATCCCAGAGTCACA 59.700 50.000 0.00 0.00 40.88 3.58
2918 5811 3.631250 ACTGGACAACCAACATCTTGTT 58.369 40.909 0.00 0.00 46.32 2.83
2937 5830 3.800261 GCATGCGACAGACATACCATACT 60.800 47.826 0.00 0.00 0.00 2.12


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.