Multiple sequence alignment - TraesCS6D01G013200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G013200 chr6D 100.000 2493 0 0 1 2493 5280206 5277714 0.000000e+00 4604
1 TraesCS6D01G013200 chr6D 97.611 2511 40 9 2 2493 42264558 42262049 0.000000e+00 4287
2 TraesCS6D01G013200 chr1D 98.362 2503 30 5 2 2493 143269208 143266706 0.000000e+00 4385
3 TraesCS6D01G013200 chr1D 97.928 2510 34 6 2 2493 203582840 203585349 0.000000e+00 4331
4 TraesCS6D01G013200 chr1D 97.927 2508 34 8 2 2493 19993802 19991297 0.000000e+00 4327
5 TraesCS6D01G013200 chr3D 98.127 2509 30 5 2 2493 68827271 68824763 0.000000e+00 4357
6 TraesCS6D01G013200 chr3D 96.774 899 16 4 2 887 414811288 414810390 0.000000e+00 1487
7 TraesCS6D01G013200 chr7D 98.088 2510 28 8 2 2493 567321990 567324497 0.000000e+00 4351
8 TraesCS6D01G013200 chr7D 97.891 2513 31 9 2 2493 589613519 589611008 0.000000e+00 4327
9 TraesCS6D01G013200 chr7D 97.644 2504 29 8 2 2493 403463705 403466190 0.000000e+00 4270
10 TraesCS6D01G013200 chr2D 98.083 2504 35 8 2 2493 54792989 54790487 0.000000e+00 4346
11 TraesCS6D01G013200 chr5D 98.009 2511 29 9 2 2493 55024006 55021498 0.000000e+00 4340
12 TraesCS6D01G013200 chr4D 97.808 2509 37 9 2 2493 433308265 433305758 0.000000e+00 4313
13 TraesCS6D01G013200 chr4D 97.375 2514 41 11 2 2493 502304542 502307052 0.000000e+00 4253
14 TraesCS6D01G013200 chr4B 96.667 150 3 2 4 152 398869688 398869836 5.320000e-62 248


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G013200 chr6D 5277714 5280206 2492 True 4604 4604 100.000 1 2493 1 chr6D.!!$R1 2492
1 TraesCS6D01G013200 chr6D 42262049 42264558 2509 True 4287 4287 97.611 2 2493 1 chr6D.!!$R2 2491
2 TraesCS6D01G013200 chr1D 143266706 143269208 2502 True 4385 4385 98.362 2 2493 1 chr1D.!!$R2 2491
3 TraesCS6D01G013200 chr1D 203582840 203585349 2509 False 4331 4331 97.928 2 2493 1 chr1D.!!$F1 2491
4 TraesCS6D01G013200 chr1D 19991297 19993802 2505 True 4327 4327 97.927 2 2493 1 chr1D.!!$R1 2491
5 TraesCS6D01G013200 chr3D 68824763 68827271 2508 True 4357 4357 98.127 2 2493 1 chr3D.!!$R1 2491
6 TraesCS6D01G013200 chr3D 414810390 414811288 898 True 1487 1487 96.774 2 887 1 chr3D.!!$R2 885
7 TraesCS6D01G013200 chr7D 567321990 567324497 2507 False 4351 4351 98.088 2 2493 1 chr7D.!!$F2 2491
8 TraesCS6D01G013200 chr7D 589611008 589613519 2511 True 4327 4327 97.891 2 2493 1 chr7D.!!$R1 2491
9 TraesCS6D01G013200 chr7D 403463705 403466190 2485 False 4270 4270 97.644 2 2493 1 chr7D.!!$F1 2491
10 TraesCS6D01G013200 chr2D 54790487 54792989 2502 True 4346 4346 98.083 2 2493 1 chr2D.!!$R1 2491
11 TraesCS6D01G013200 chr5D 55021498 55024006 2508 True 4340 4340 98.009 2 2493 1 chr5D.!!$R1 2491
12 TraesCS6D01G013200 chr4D 433305758 433308265 2507 True 4313 4313 97.808 2 2493 1 chr4D.!!$R1 2491
13 TraesCS6D01G013200 chr4D 502304542 502307052 2510 False 4253 4253 97.375 2 2493 1 chr4D.!!$F1 2491

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
807 852 1.00358 TCCATCTGACAGACAAAGGCC 59.996 52.381 7.47 0.0 0.0 5.19 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1672 1722 5.817816 GGGTATGATCCAACACTCAAGTTAG 59.182 44.0 0.0 0.0 0.0 2.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
490 534 4.018233 TCAAACCCTAATAACCCCGTTGAT 60.018 41.667 0.00 0.00 0.00 2.57
505 549 2.639065 GTTGATTCGCTCATAACCCCA 58.361 47.619 0.00 0.00 32.72 4.96
529 573 1.032114 AATGCTCCAAACCCTAGCGC 61.032 55.000 0.00 0.00 39.14 5.92
602 646 2.512286 CAGGCATGCACGATCCGT 60.512 61.111 21.36 0.00 42.36 4.69
807 852 1.003580 TCCATCTGACAGACAAAGGCC 59.996 52.381 7.47 0.00 0.00 5.19
869 914 3.611970 TCTCGTTCTTCTTCCTCTCGAT 58.388 45.455 0.00 0.00 0.00 3.59
1159 1209 6.459066 TCCTCGCATCCTTTATCTCTAATTG 58.541 40.000 0.00 0.00 0.00 2.32
1354 1404 1.598517 GGAATACCCGACGGTGGTT 59.401 57.895 13.94 3.84 44.40 3.67
1364 1414 1.068474 GACGGTGGTTGATGTCGAAG 58.932 55.000 0.00 0.00 0.00 3.79
1373 1423 3.305964 GTTGATGTCGAAGTGAAGACGA 58.694 45.455 0.00 0.00 40.05 4.20
1672 1722 9.722056 CAGTGATAGGATTATTTTGTTAGCAAC 57.278 33.333 0.00 0.00 33.82 4.17
1705 1756 2.958818 TGGATCATACCCTAGCTCGTT 58.041 47.619 0.00 0.00 0.00 3.85
1974 2027 6.506147 TCATTAATTTGATTGCCCAATCTCG 58.494 36.000 18.63 2.99 45.55 4.04
2273 2329 3.567478 ACAGAGCTCTCAAACCAAAGT 57.433 42.857 14.96 2.14 0.00 2.66
2370 2427 2.044451 CCCCACGCCAATTAGCCA 60.044 61.111 0.00 0.00 0.00 4.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
444 488 4.776837 ACCAGATTTCAAATGGCCATAACA 59.223 37.500 21.15 2.02 37.64 2.41
490 534 1.271856 TCTGTGGGGTTATGAGCGAA 58.728 50.000 0.00 0.00 0.00 4.70
505 549 2.683211 AGGGTTTGGAGCATTTCTGT 57.317 45.000 0.00 0.00 0.00 3.41
550 594 0.538516 TGGTGTTTGGCGCTTGGTAT 60.539 50.000 7.64 0.00 0.00 2.73
594 638 0.530650 GGATGCATCACACGGATCGT 60.531 55.000 27.25 0.00 42.36 3.73
602 646 1.064240 AGCCAATCAGGATGCATCACA 60.064 47.619 27.25 11.11 41.22 3.58
807 852 2.411904 GAATTGCCCTATCTGCTCGAG 58.588 52.381 8.45 8.45 0.00 4.04
869 914 4.141041 TGGGGAAAGAAACAGAGGAATTGA 60.141 41.667 0.00 0.00 0.00 2.57
1354 1404 3.636282 TTCGTCTTCACTTCGACATCA 57.364 42.857 0.00 0.00 33.38 3.07
1364 1414 7.121974 TCATCTTCTTCAATTTCGTCTTCAC 57.878 36.000 0.00 0.00 0.00 3.18
1373 1423 9.741647 GAAGTTCTTGTTCATCTTCTTCAATTT 57.258 29.630 0.00 0.00 33.86 1.82
1672 1722 5.817816 GGGTATGATCCAACACTCAAGTTAG 59.182 44.000 0.00 0.00 0.00 2.34
1705 1756 6.404844 GCTCAAGTACTGCTTACTGTCATCTA 60.405 42.308 0.00 0.00 40.44 1.98
2370 2427 6.783708 TTTGTTTGTCCCAAGTTTAGACAT 57.216 33.333 5.74 0.00 40.06 3.06


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.