Multiple sequence alignment - TraesCS6B01G464700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G464700 chr6B 100.000 1861 0 0 374 2234 715991687 715993547 0.000000e+00 3437
1 TraesCS6B01G464700 chr6B 98.497 1863 24 4 374 2234 596602208 596604068 0.000000e+00 3282
2 TraesCS6B01G464700 chr6B 100.000 192 0 0 1 192 715991314 715991505 2.730000e-94 355
3 TraesCS6B01G464700 chr6B 99.479 192 0 1 1 192 596602101 596602291 4.570000e-92 348
4 TraesCS6B01G464700 chrUn 98.496 1862 26 2 374 2234 171007936 171006076 0.000000e+00 3282
5 TraesCS6B01G464700 chrUn 99.479 192 0 1 1 192 171008043 171007853 4.570000e-92 348
6 TraesCS6B01G464700 chrUn 98.958 192 2 0 1 192 432742111 432741920 5.910000e-91 344
7 TraesCS6B01G464700 chr7A 98.442 1861 27 2 374 2233 638508015 638509874 0.000000e+00 3275
8 TraesCS6B01G464700 chr7A 98.122 1864 31 4 374 2234 708245277 708243415 0.000000e+00 3245
9 TraesCS6B01G464700 chr7A 98.958 192 2 0 1 192 638507907 638508098 5.910000e-91 344
10 TraesCS6B01G464700 chr1B 98.120 1862 32 3 374 2234 672540873 672539014 0.000000e+00 3241
11 TraesCS6B01G464700 chr7B 97.961 1864 30 6 374 2234 54050216 54052074 0.000000e+00 3225
12 TraesCS6B01G464700 chr1D 97.853 1863 32 4 374 2234 212445922 212447778 0.000000e+00 3212
13 TraesCS6B01G464700 chr1D 98.958 192 1 1 1 192 275786829 275787019 2.120000e-90 342
14 TraesCS6B01G464700 chr5B 97.799 1863 38 3 374 2234 567279645 567277784 0.000000e+00 3210
15 TraesCS6B01G464700 chr5B 100.000 192 0 0 1 192 567279753 567279562 2.730000e-94 355
16 TraesCS6B01G464700 chr5B 98.958 192 1 1 1 192 169046326 169046516 2.120000e-90 342
17 TraesCS6B01G464700 chr2B 97.799 1863 38 3 374 2234 391225593 391227454 0.000000e+00 3210
18 TraesCS6B01G464700 chr2B 98.958 192 0 1 1 192 357228543 357228354 2.120000e-90 342
19 TraesCS6B01G464700 chr2B 98.446 193 2 1 1 192 391225484 391225676 2.750000e-89 339


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G464700 chr6B 715991314 715993547 2233 False 1896.0 3437 100.0000 1 2234 2 chr6B.!!$F2 2233
1 TraesCS6B01G464700 chr6B 596602101 596604068 1967 False 1815.0 3282 98.9880 1 2234 2 chr6B.!!$F1 2233
2 TraesCS6B01G464700 chrUn 171006076 171008043 1967 True 1815.0 3282 98.9875 1 2234 2 chrUn.!!$R2 2233
3 TraesCS6B01G464700 chr7A 708243415 708245277 1862 True 3245.0 3245 98.1220 374 2234 1 chr7A.!!$R1 1860
4 TraesCS6B01G464700 chr7A 638507907 638509874 1967 False 1809.5 3275 98.7000 1 2233 2 chr7A.!!$F1 2232
5 TraesCS6B01G464700 chr1B 672539014 672540873 1859 True 3241.0 3241 98.1200 374 2234 1 chr1B.!!$R1 1860
6 TraesCS6B01G464700 chr7B 54050216 54052074 1858 False 3225.0 3225 97.9610 374 2234 1 chr7B.!!$F1 1860
7 TraesCS6B01G464700 chr1D 212445922 212447778 1856 False 3212.0 3212 97.8530 374 2234 1 chr1D.!!$F1 1860
8 TraesCS6B01G464700 chr5B 567277784 567279753 1969 True 1782.5 3210 98.8995 1 2234 2 chr5B.!!$R1 2233
9 TraesCS6B01G464700 chr2B 391225484 391227454 1970 False 1774.5 3210 98.1225 1 2234 2 chr2B.!!$F1 2233

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
586 588 0.036306 AATGATTATCCCCGCCCGAC 59.964 55.0 0.0 0.0 0.0 4.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1888 1898 1.080093 GCGATGGTGACGAGGAACA 60.08 57.895 0.0 0.0 0.0 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
186 188 7.739498 TTGGATATTAAGGAAGCCGTATTTC 57.261 36.000 0.00 0.0 0.00 2.17
187 189 5.929992 TGGATATTAAGGAAGCCGTATTTCG 59.070 40.000 0.00 0.0 39.52 3.46
188 190 5.163884 GGATATTAAGGAAGCCGTATTTCGC 60.164 44.000 0.00 0.0 38.35 4.70
189 191 2.676632 TAAGGAAGCCGTATTTCGCA 57.323 45.000 0.00 0.0 38.35 5.10
190 192 1.816074 AAGGAAGCCGTATTTCGCAA 58.184 45.000 0.00 0.0 38.35 4.85
191 193 2.038387 AGGAAGCCGTATTTCGCAAT 57.962 45.000 0.00 0.0 38.35 3.56
586 588 0.036306 AATGATTATCCCCGCCCGAC 59.964 55.000 0.00 0.0 0.00 4.79
656 658 3.618019 GCCATTCTTGTAACCGTCACCTA 60.618 47.826 0.00 0.0 0.00 3.08
797 801 8.030106 GGTACATATATAAGTCAGTGGAAGAGC 58.970 40.741 0.00 0.0 0.00 4.09
825 829 3.626222 GGTCACCACTACTGAGGATCTCT 60.626 52.174 0.00 0.0 34.92 3.10
1005 1009 0.168128 GGAAAGCCCAACGAATGTCG 59.832 55.000 0.00 0.0 39.45 4.35
1077 1085 2.978156 AAGAGCAGACCCCATTGAAA 57.022 45.000 0.00 0.0 0.00 2.69
1438 1446 2.575532 CAGAGACAAAAGCAGTCCCAA 58.424 47.619 0.00 0.0 36.68 4.12
1448 1456 1.134220 AGCAGTCCCAAACGAAACTGA 60.134 47.619 5.59 0.0 41.26 3.41
1449 1457 1.673920 GCAGTCCCAAACGAAACTGAA 59.326 47.619 5.59 0.0 41.26 3.02
1641 1649 6.822170 AGTAGAACTTCGTTTTGAGGAGTTTT 59.178 34.615 0.00 0.0 0.00 2.43
1647 1655 2.751816 CGTTTTGAGGAGTTTTCCCCCT 60.752 50.000 0.00 0.0 45.24 4.79
1888 1898 1.289244 ATGATCTCCCCGGCCCTTTT 61.289 55.000 0.00 0.0 0.00 2.27
2217 2229 1.306654 CCACCCCTACTACTGCCCA 60.307 63.158 0.00 0.0 0.00 5.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
411 413 3.053359 TCCAAATTTCAACAAGGGGGT 57.947 42.857 0.00 0.0 0.00 4.95
586 588 2.039418 TCAGGGATGAATGTAGACCCG 58.961 52.381 0.00 0.0 44.57 5.28
656 658 1.006832 GACACACTTGCGCGGATTAT 58.993 50.000 8.83 0.0 0.00 1.28
797 801 1.697432 TCAGTAGTGGTGACCCTTTGG 59.303 52.381 0.00 0.0 37.80 3.28
1005 1009 4.133796 GTGCGGGGCTTTGCATCC 62.134 66.667 0.00 0.0 43.96 3.51
1077 1085 3.244911 CCTTGTTGTACCTCACTCCCATT 60.245 47.826 0.00 0.0 0.00 3.16
1438 1446 5.346181 TGGGGAAAATTTTCAGTTTCGTT 57.654 34.783 27.53 0.0 37.78 3.85
1888 1898 1.080093 GCGATGGTGACGAGGAACA 60.080 57.895 0.00 0.0 0.00 3.18
1941 1951 6.099125 CCTTTGGGGTTTTCTTTTTCCTTCTA 59.901 38.462 0.00 0.0 0.00 2.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.