Multiple sequence alignment - TraesCS6B01G454600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G454600 chr6B 100.000 3148 0 0 1 3148 712151963 712155110 0 5814
1 TraesCS6B01G454600 chr6B 96.033 3151 109 9 2 3145 366596219 366593078 0 5112
2 TraesCS6B01G454600 chr1B 98.444 3150 34 3 1 3148 6396425 6399561 0 5531
3 TraesCS6B01G454600 chr4A 97.905 3150 52 4 1 3148 58507736 58510873 0 5439
4 TraesCS6B01G454600 chr7A 97.778 3150 55 5 1 3148 11051379 11048243 0 5415
5 TraesCS6B01G454600 chr2D 95.055 3155 132 17 2 3145 46693701 46690560 0 4940
6 TraesCS6B01G454600 chr7D 94.772 3156 136 21 2 3145 615778546 615781684 0 4887
7 TraesCS6B01G454600 chr3B 94.703 3153 132 15 2 3145 465857905 465861031 0 4865
8 TraesCS6B01G454600 chr5D 94.629 2867 127 19 2 2857 41776700 41779550 0 4416
9 TraesCS6B01G454600 chr6A 94.474 2443 126 7 607 3047 61567833 61565398 0 3755
10 TraesCS6B01G454600 chr6D 94.226 2338 113 14 2 2330 429473886 429476210 0 3550


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G454600 chr6B 712151963 712155110 3147 False 5814 5814 100.000 1 3148 1 chr6B.!!$F1 3147
1 TraesCS6B01G454600 chr6B 366593078 366596219 3141 True 5112 5112 96.033 2 3145 1 chr6B.!!$R1 3143
2 TraesCS6B01G454600 chr1B 6396425 6399561 3136 False 5531 5531 98.444 1 3148 1 chr1B.!!$F1 3147
3 TraesCS6B01G454600 chr4A 58507736 58510873 3137 False 5439 5439 97.905 1 3148 1 chr4A.!!$F1 3147
4 TraesCS6B01G454600 chr7A 11048243 11051379 3136 True 5415 5415 97.778 1 3148 1 chr7A.!!$R1 3147
5 TraesCS6B01G454600 chr2D 46690560 46693701 3141 True 4940 4940 95.055 2 3145 1 chr2D.!!$R1 3143
6 TraesCS6B01G454600 chr7D 615778546 615781684 3138 False 4887 4887 94.772 2 3145 1 chr7D.!!$F1 3143
7 TraesCS6B01G454600 chr3B 465857905 465861031 3126 False 4865 4865 94.703 2 3145 1 chr3B.!!$F1 3143
8 TraesCS6B01G454600 chr5D 41776700 41779550 2850 False 4416 4416 94.629 2 2857 1 chr5D.!!$F1 2855
9 TraesCS6B01G454600 chr6A 61565398 61567833 2435 True 3755 3755 94.474 607 3047 1 chr6A.!!$R1 2440
10 TraesCS6B01G454600 chr6D 429473886 429476210 2324 False 3550 3550 94.226 2 2330 1 chr6D.!!$F1 2328

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
848 858 3.713902 CAGTGAAGTTGGCTGGACT 57.286 52.632 0.0 0.0 0.0 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2634 2654 3.817084 TCAATGCTGTTTGAGACAAGGAG 59.183 43.478 0.0 0.0 37.93 3.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
799 809 4.850680 ACAACAACTCAAAGTGGTTCCTA 58.149 39.130 0.00 0.0 40.25 2.94
848 858 3.713902 CAGTGAAGTTGGCTGGACT 57.286 52.632 0.00 0.0 0.00 3.85
1533 1543 2.576832 CCACTGCAAAAGGCCTGGG 61.577 63.158 5.69 0.0 43.89 4.45
2460 2480 3.003394 TCTGGGCATCATGGTTTGTAG 57.997 47.619 0.00 0.0 0.00 2.74
2634 2654 2.297701 TGAACCAGGAGTTTGAACAGC 58.702 47.619 0.00 0.0 39.40 4.40
2649 2669 3.206150 GAACAGCTCCTTGTCTCAAACA 58.794 45.455 0.00 0.0 35.59 2.83
2870 2890 4.313282 CTGCTGAGTGTCTCTTGAAATCA 58.687 43.478 0.00 0.0 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
9 10 2.625314 CACCGATCCATTCTCTCTGCTA 59.375 50.000 0.00 0.00 0.00 3.49
750 759 6.271488 TGCTGCTCAATACTTTGCTTAAAT 57.729 33.333 0.00 0.00 32.61 1.40
848 858 1.685803 CCCAGCTGATGTAATTGCCCA 60.686 52.381 17.39 0.00 0.00 5.36
1533 1543 3.308438 AAGCATGAATCCTTTGTGTGC 57.692 42.857 0.00 0.00 0.00 4.57
2460 2480 5.796813 ACGACTAAAGCAATCGATAAAAGC 58.203 37.500 0.00 0.89 39.16 3.51
2634 2654 3.817084 TCAATGCTGTTTGAGACAAGGAG 59.183 43.478 0.00 0.00 37.93 3.69
2649 2669 5.048504 CACAGGTAGTTTGATGTTCAATGCT 60.049 40.000 0.00 0.00 36.11 3.79
2795 2815 6.086241 GCATACGGTTTATCAAATATGTTGCG 59.914 38.462 0.00 0.00 0.00 4.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.