Multiple sequence alignment - TraesCS6B01G443100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G443100 chr6B 100.000 3915 0 0 1 3915 706410774 706406860 0.000000e+00 7230
1 TraesCS6B01G443100 chr6B 99.438 3917 19 3 1 3915 706353789 706349874 0.000000e+00 7108
2 TraesCS6B01G443100 chr6B 94.694 3939 156 25 1 3915 705785737 705781828 0.000000e+00 6067
3 TraesCS6B01G443100 chr6B 93.135 3030 153 22 903 3915 705758761 705755770 0.000000e+00 4392
4 TraesCS6B01G443100 chr6B 88.776 1675 155 17 1431 3092 706528980 706527326 0.000000e+00 2021
5 TraesCS6B01G443100 chr6B 88.259 1729 150 24 1377 3092 706443982 706442294 0.000000e+00 2019
6 TraesCS6B01G443100 chr6B 94.378 1245 50 6 1347 2578 706098127 706096890 0.000000e+00 1893
7 TraesCS6B01G443100 chr6B 91.005 856 47 13 1 845 706524576 706523740 0.000000e+00 1127
8 TraesCS6B01G443100 chr6B 91.497 788 50 11 28 802 705760917 705760134 0.000000e+00 1068
9 TraesCS6B01G443100 chr6B 95.568 361 15 1 838 1198 706523715 706523356 9.430000e-161 577
10 TraesCS6B01G443100 chr6B 83.915 659 40 31 691 1329 706112694 706112082 1.580000e-158 569
11 TraesCS6B01G443100 chr6B 88.814 447 37 9 386 826 706113257 706112818 1.600000e-148 536
12 TraesCS6B01G443100 chr6B 89.567 393 18 10 1 377 706113831 706113446 9.840000e-131 477
13 TraesCS6B01G443100 chr6B 89.352 216 16 3 954 1168 706444716 706444507 8.340000e-67 265
14 TraesCS6B01G443100 chr6B 88.688 221 18 3 954 1173 706529796 706529582 3.000000e-66 263
15 TraesCS6B01G443100 chr6B 90.449 178 17 0 1209 1386 706529421 706529244 6.540000e-58 235
16 TraesCS6B01G443100 chr6B 89.888 178 18 0 1209 1386 706444343 706444166 3.040000e-56 230
17 TraesCS6B01G443100 chr6D 95.075 3736 147 22 1 3709 463075137 463071412 0.000000e+00 5845
18 TraesCS6B01G443100 chr6D 92.337 1553 99 14 2169 3709 463069054 463067510 0.000000e+00 2191
19 TraesCS6B01G443100 chr6D 89.145 1732 145 21 1377 3092 463079999 463078295 0.000000e+00 2117
20 TraesCS6B01G443100 chr6D 80.059 677 118 14 3247 3913 266323380 266322711 1.640000e-133 486
21 TraesCS6B01G443100 chr6D 84.712 399 43 14 455 845 470466492 470466104 2.210000e-102 383
22 TraesCS6B01G443100 chr6D 83.838 396 46 15 460 845 289521405 289521018 1.030000e-95 361
23 TraesCS6B01G443100 chr6D 90.588 170 14 1 1214 1383 463091076 463090909 1.420000e-54 224
24 TraesCS6B01G443100 chr6A 91.916 2140 126 15 1327 3463 609815278 609813183 0.000000e+00 2950
25 TraesCS6B01G443100 chr6A 88.606 1729 157 17 1377 3092 609821474 609819773 0.000000e+00 2065
26 TraesCS6B01G443100 chr6A 85.452 708 78 12 145 845 609817055 609816366 0.000000e+00 713
27 TraesCS6B01G443100 chr6A 87.200 375 14 14 956 1330 609816247 609815907 2.830000e-106 396
28 TraesCS6B01G443100 chr6A 86.957 230 20 4 954 1182 609821821 609821601 2.340000e-62 250
29 TraesCS6B01G443100 chr6A 93.636 110 7 0 39 148 609817207 609817098 8.700000e-37 165
30 TraesCS6B01G443100 chr3B 82.583 689 105 11 3237 3915 640670921 640670238 9.370000e-166 593
31 TraesCS6B01G443100 chr3D 82.533 687 101 15 3234 3913 306267159 306266485 1.570000e-163 586
32 TraesCS6B01G443100 chr4D 82.018 684 106 13 3241 3915 463924265 463924940 2.040000e-157 566
33 TraesCS6B01G443100 chrUn 80.743 296 35 10 146 425 12497960 12498249 1.100000e-50 211
34 TraesCS6B01G443100 chr2D 88.235 136 16 0 3099 3234 524332336 524332201 3.130000e-36 163
35 TraesCS6B01G443100 chr4A 88.235 136 14 1 3097 3230 603722677 603722542 1.130000e-35 161
36 TraesCS6B01G443100 chr2A 84.967 153 17 5 3084 3234 197486357 197486505 2.440000e-32 150


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G443100 chr6B 706406860 706410774 3914 True 7230.000000 7230 100.000000 1 3915 1 chr6B.!!$R4 3914
1 TraesCS6B01G443100 chr6B 706349874 706353789 3915 True 7108.000000 7108 99.438000 1 3915 1 chr6B.!!$R3 3914
2 TraesCS6B01G443100 chr6B 705781828 705785737 3909 True 6067.000000 6067 94.694000 1 3915 1 chr6B.!!$R1 3914
3 TraesCS6B01G443100 chr6B 705755770 705760917 5147 True 2730.000000 4392 92.316000 28 3915 2 chr6B.!!$R5 3887
4 TraesCS6B01G443100 chr6B 706096890 706098127 1237 True 1893.000000 1893 94.378000 1347 2578 1 chr6B.!!$R2 1231
5 TraesCS6B01G443100 chr6B 706523356 706529796 6440 True 844.600000 2021 90.897200 1 3092 5 chr6B.!!$R8 3091
6 TraesCS6B01G443100 chr6B 706442294 706444716 2422 True 838.000000 2019 89.166333 954 3092 3 chr6B.!!$R7 2138
7 TraesCS6B01G443100 chr6B 706112082 706113831 1749 True 527.333333 569 87.432000 1 1329 3 chr6B.!!$R6 1328
8 TraesCS6B01G443100 chr6D 463067510 463079999 12489 True 3384.333333 5845 92.185667 1 3709 3 chr6D.!!$R5 3708
9 TraesCS6B01G443100 chr6D 266322711 266323380 669 True 486.000000 486 80.059000 3247 3913 1 chr6D.!!$R1 666
10 TraesCS6B01G443100 chr6A 609813183 609821821 8638 True 1089.833333 2950 88.961167 39 3463 6 chr6A.!!$R1 3424
11 TraesCS6B01G443100 chr3B 640670238 640670921 683 True 593.000000 593 82.583000 3237 3915 1 chr3B.!!$R1 678
12 TraesCS6B01G443100 chr3D 306266485 306267159 674 True 586.000000 586 82.533000 3234 3913 1 chr3D.!!$R1 679
13 TraesCS6B01G443100 chr4D 463924265 463924940 675 False 566.000000 566 82.018000 3241 3915 1 chr4D.!!$F1 674

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
348 5274 7.274468 CGATCGCTGTCTCTATTAAGCAATATT 59.726 37.037 0.26 0.0 35.33 1.28 F
1185 7889 5.136220 TCCTCCTCCTGAATCCTGATTACTA 59.864 44.000 0.00 0.0 0.00 1.82 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1709 9620 1.066257 GCTGGTGTGCCAAGTTGTG 59.934 57.895 1.45 0.0 45.51 3.33 R
2964 10900 4.077108 ACGTGAAACTCCCCTTTTAATCC 58.923 43.478 0.00 0.0 31.75 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
348 5274 7.274468 CGATCGCTGTCTCTATTAAGCAATATT 59.726 37.037 0.26 0.00 35.33 1.28
1185 7889 5.136220 TCCTCCTCCTGAATCCTGATTACTA 59.864 44.000 0.00 0.00 0.00 1.82
1709 9620 2.156343 ACGACTCAAGACAAGCCTTC 57.844 50.000 0.00 0.00 0.00 3.46
2842 10771 1.452399 GCTCACGAAGAAGACGTCAAC 59.548 52.381 19.50 10.97 42.07 3.18
3268 11966 4.271016 GATGGTCATCCCCGGCCC 62.271 72.222 0.00 0.00 31.76 5.80
3891 16064 1.406069 CCTTGGTCTGAATCACCTCCG 60.406 57.143 0.00 0.00 34.66 4.63
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
4 5 3.534889 CACTATACAATGCAATGACGCG 58.465 45.455 9.20 3.53 33.35 6.01
1709 9620 1.066257 GCTGGTGTGCCAAGTTGTG 59.934 57.895 1.45 0.00 45.51 3.33
2842 10771 6.258727 CAGGTAGTACAATGATAGGTTTGCTG 59.741 42.308 2.06 0.00 0.00 4.41
2964 10900 4.077108 ACGTGAAACTCCCCTTTTAATCC 58.923 43.478 0.00 0.00 31.75 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.