Multiple sequence alignment - TraesCS6B01G439000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G439000 chr6B 100.000 2924 0 0 1 2924 704850703 704847780 0.000000e+00 5400
1 TraesCS6B01G439000 chr6B 98.906 2924 30 2 1 2924 408661943 408664864 0.000000e+00 5221
2 TraesCS6B01G439000 chr5B 99.145 2924 22 3 1 2924 179227002 179229922 0.000000e+00 5258
3 TraesCS6B01G439000 chr5B 98.906 2926 28 4 1 2924 406870615 406867692 0.000000e+00 5223
4 TraesCS6B01G439000 chr7B 99.042 2924 25 3 1 2924 528879484 528882404 0.000000e+00 5241
5 TraesCS6B01G439000 chr2A 98.872 2925 28 5 1 2924 719453777 719456697 0.000000e+00 5214
6 TraesCS6B01G439000 chr2A 98.804 2926 29 6 1 2924 43380271 43383192 0.000000e+00 5204
7 TraesCS6B01G439000 chr2A 91.211 2742 141 41 221 2924 17677299 17674620 0.000000e+00 3637
8 TraesCS6B01G439000 chr2A 91.429 140 8 3 1 138 17677430 17677293 3.850000e-44 189
9 TraesCS6B01G439000 chr4B 98.702 2927 34 4 1 2924 194219138 194222063 0.000000e+00 5192
10 TraesCS6B01G439000 chr7A 98.394 2927 24 10 1 2924 171418632 171421538 0.000000e+00 5123
11 TraesCS6B01G439000 chr1A 99.013 2331 21 2 594 2924 567477552 567475224 0.000000e+00 4176


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G439000 chr6B 704847780 704850703 2923 True 5400 5400 100.000 1 2924 1 chr6B.!!$R1 2923
1 TraesCS6B01G439000 chr6B 408661943 408664864 2921 False 5221 5221 98.906 1 2924 1 chr6B.!!$F1 2923
2 TraesCS6B01G439000 chr5B 179227002 179229922 2920 False 5258 5258 99.145 1 2924 1 chr5B.!!$F1 2923
3 TraesCS6B01G439000 chr5B 406867692 406870615 2923 True 5223 5223 98.906 1 2924 1 chr5B.!!$R1 2923
4 TraesCS6B01G439000 chr7B 528879484 528882404 2920 False 5241 5241 99.042 1 2924 1 chr7B.!!$F1 2923
5 TraesCS6B01G439000 chr2A 719453777 719456697 2920 False 5214 5214 98.872 1 2924 1 chr2A.!!$F2 2923
6 TraesCS6B01G439000 chr2A 43380271 43383192 2921 False 5204 5204 98.804 1 2924 1 chr2A.!!$F1 2923
7 TraesCS6B01G439000 chr2A 17674620 17677430 2810 True 1913 3637 91.320 1 2924 2 chr2A.!!$R1 2923
8 TraesCS6B01G439000 chr4B 194219138 194222063 2925 False 5192 5192 98.702 1 2924 1 chr4B.!!$F1 2923
9 TraesCS6B01G439000 chr7A 171418632 171421538 2906 False 5123 5123 98.394 1 2924 1 chr7A.!!$F1 2923
10 TraesCS6B01G439000 chr1A 567475224 567477552 2328 True 4176 4176 99.013 594 2924 1 chr1A.!!$R1 2330

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
276 299 2.092753 AGGTGTAGGTTGCATGATCCTG 60.093 50.000 0.00 0.0 33.34 3.86 F
572 607 4.081752 GGACAAACATATGTTGCCCATGAA 60.082 41.667 21.46 0.0 38.44 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1412 1449 1.228154 ACTCCGGTTTTCACAGCCC 60.228 57.895 0.0 0.0 0.0 5.19 R
2037 2081 4.487714 ACAAAGACAAGACAACAGAGGA 57.512 40.909 0.0 0.0 0.0 3.71 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
276 299 2.092753 AGGTGTAGGTTGCATGATCCTG 60.093 50.000 0.00 0.0 33.34 3.86
572 607 4.081752 GGACAAACATATGTTGCCCATGAA 60.082 41.667 21.46 0.0 38.44 2.57
954 991 5.438761 ACTTGCTTGACATCAAACTAACC 57.561 39.130 0.00 0.0 35.15 2.85
1425 1462 0.961753 CAAGGAGGGCTGTGAAAACC 59.038 55.000 0.00 0.0 0.00 3.27
1860 1902 6.013984 ACCCTTCTCTCCGACAATTTTAACTA 60.014 38.462 0.00 0.0 0.00 2.24
2384 2433 3.895704 AGGTAACAAGGGTTTGACCAT 57.104 42.857 0.00 0.0 37.86 3.55
2786 2836 3.717576 TGGGCAATCATTTATGTTGGGA 58.282 40.909 0.00 0.0 0.00 4.37
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
417 442 1.971962 GAATTGTTTCTTCGTGCTGCG 59.028 47.619 0.00 0.00 43.01 5.18
954 991 6.976636 TTTAAACCAGAAAAACCAAAGCTG 57.023 33.333 0.00 0.00 0.00 4.24
1412 1449 1.228154 ACTCCGGTTTTCACAGCCC 60.228 57.895 0.00 0.00 0.00 5.19
1425 1462 8.100032 ACAAACTGTTGTTTTATCAACACTCCG 61.100 37.037 7.95 2.67 46.01 4.63
2037 2081 4.487714 ACAAAGACAAGACAACAGAGGA 57.512 40.909 0.00 0.00 0.00 3.71
2384 2433 7.345422 TGGAGTCAAAATGAAGTCAAAATGA 57.655 32.000 0.00 0.00 0.00 2.57
2786 2836 3.074412 CTCTTGCCTAACGAAACCACAT 58.926 45.455 0.00 0.00 0.00 3.21


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.