Multiple sequence alignment - TraesCS6B01G434500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G434500 chr6B 100.000 2484 0 0 1 2484 702939658 702942141 0.000000e+00 4588.0
1 TraesCS6B01G434500 chr6B 98.390 1677 21 3 655 2325 702985161 702986837 0.000000e+00 2942.0
2 TraesCS6B01G434500 chr6B 86.268 1624 122 38 655 2242 49898964 49900522 0.000000e+00 1670.0
3 TraesCS6B01G434500 chr6B 95.233 1007 23 4 1479 2484 702915736 702916718 0.000000e+00 1570.0
4 TraesCS6B01G434500 chr6B 97.104 656 18 1 1 655 702984298 702984953 0.000000e+00 1105.0
5 TraesCS6B01G434500 chr6B 95.427 656 27 2 1 655 702913658 702914311 0.000000e+00 1042.0
6 TraesCS6B01G434500 chr6B 96.965 593 13 3 1897 2484 703100105 703100697 0.000000e+00 990.0
7 TraesCS6B01G434500 chr6B 96.791 592 15 2 1897 2484 703050500 703051091 0.000000e+00 985.0
8 TraesCS6B01G434500 chr6B 96.791 592 14 3 1897 2484 703001820 703002410 0.000000e+00 983.0
9 TraesCS6B01G434500 chr6B 95.519 491 8 1 1062 1538 702915267 702915757 0.000000e+00 773.0
10 TraesCS6B01G434500 chr6B 98.028 355 6 1 655 1009 702914502 702914855 1.260000e-172 616.0
11 TraesCS6B01G434500 chr6B 95.276 127 5 1 2359 2484 702986815 702986941 1.510000e-47 200.0
12 TraesCS6B01G434500 chr6B 92.157 102 8 0 2379 2480 49900520 49900621 7.160000e-31 145.0
13 TraesCS6B01G434500 chr6D 92.136 1119 68 5 655 1759 27229525 27230637 0.000000e+00 1561.0
14 TraesCS6B01G434500 chr6D 91.016 768 63 4 1479 2242 27147519 27148284 0.000000e+00 1031.0
15 TraesCS6B01G434500 chr6D 91.568 593 34 4 962 1538 27146948 27147540 0.000000e+00 804.0
16 TraesCS6B01G434500 chr6D 91.706 422 21 7 1970 2388 27298059 27298469 7.710000e-160 573.0
17 TraesCS6B01G434500 chr6D 93.548 248 15 1 655 902 27146680 27146926 3.900000e-98 368.0
18 TraesCS6B01G434500 chr6D 92.381 105 7 1 2379 2483 27148282 27148385 5.540000e-32 148.0
19 TraesCS6B01G434500 chr6A 93.296 179 12 0 1388 1566 31127321 31127143 5.270000e-67 265.0
20 TraesCS6B01G434500 chr6A 90.419 167 10 3 2080 2242 31127145 31126981 5.380000e-52 215.0
21 TraesCS6B01G434500 chr3B 76.998 413 56 23 276 655 564761863 564762269 1.510000e-47 200.0
22 TraesCS6B01G434500 chr5B 76.627 415 57 24 276 655 681919694 681920103 2.520000e-45 193.0
23 TraesCS6B01G434500 chr5B 76.145 415 59 24 276 655 681920492 681920901 5.460000e-42 182.0
24 TraesCS6B01G434500 chr5A 76.486 387 71 12 276 655 573088090 573088463 2.520000e-45 193.0
25 TraesCS6B01G434500 chr2B 78.873 284 37 16 391 655 688429590 688429869 1.180000e-38 171.0
26 TraesCS6B01G434500 chr2D 74.745 392 64 21 295 654 451693580 451693968 2.580000e-30 143.0
27 TraesCS6B01G434500 chr7A 76.241 282 54 10 382 655 709699870 709699594 1.200000e-28 137.0
28 TraesCS6B01G434500 chr7A 80.153 131 23 3 369 497 434731467 434731596 7.310000e-16 95.3
29 TraesCS6B01G434500 chr7D 86.154 130 10 5 532 655 524327908 524328035 1.550000e-27 134.0
30 TraesCS6B01G434500 chr3A 82.877 146 23 2 511 655 698840365 698840509 2.000000e-26 130.0
31 TraesCS6B01G434500 chr4A 75.333 300 51 13 377 655 125375938 125376235 3.350000e-24 122.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G434500 chr6B 702939658 702942141 2483 False 4588.000000 4588 100.000000 1 2484 1 chr6B.!!$F1 2483
1 TraesCS6B01G434500 chr6B 702984298 702986941 2643 False 1415.666667 2942 96.923333 1 2484 3 chr6B.!!$F7 2483
2 TraesCS6B01G434500 chr6B 702913658 702916718 3060 False 1000.250000 1570 96.051750 1 2484 4 chr6B.!!$F6 2483
3 TraesCS6B01G434500 chr6B 703100105 703100697 592 False 990.000000 990 96.965000 1897 2484 1 chr6B.!!$F4 587
4 TraesCS6B01G434500 chr6B 703050500 703051091 591 False 985.000000 985 96.791000 1897 2484 1 chr6B.!!$F3 587
5 TraesCS6B01G434500 chr6B 703001820 703002410 590 False 983.000000 983 96.791000 1897 2484 1 chr6B.!!$F2 587
6 TraesCS6B01G434500 chr6B 49898964 49900621 1657 False 907.500000 1670 89.212500 655 2480 2 chr6B.!!$F5 1825
7 TraesCS6B01G434500 chr6D 27229525 27230637 1112 False 1561.000000 1561 92.136000 655 1759 1 chr6D.!!$F1 1104
8 TraesCS6B01G434500 chr6D 27146680 27148385 1705 False 587.750000 1031 92.128250 655 2483 4 chr6D.!!$F3 1828

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
512 513 0.250513 GGATCCGCTTGAGTCCAGTT 59.749 55.0 0.0 0.0 0.0 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2030 2733 0.53087 GCTAGGAATGAGCCGGTGTC 60.531 60.0 1.9 0.33 33.6 3.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
371 372 0.321346 GGGTTTGGCCATGTTCAAGG 59.679 55.000 6.09 0.00 39.65 3.61
420 421 4.590647 AGATGGAATAAGATTCTCCTCGCA 59.409 41.667 0.00 0.00 0.00 5.10
509 510 1.612146 TGGGATCCGCTTGAGTCCA 60.612 57.895 5.45 0.00 32.31 4.02
512 513 0.250513 GGATCCGCTTGAGTCCAGTT 59.749 55.000 0.00 0.00 0.00 3.16
568 569 4.500035 GGATCCTTTCGATCTACGCTTCTT 60.500 45.833 3.84 0.00 45.90 2.52
635 637 5.607119 ATTTAGCACGACGACTTTTCAAT 57.393 34.783 0.00 0.00 0.00 2.57
795 1008 6.294508 CGTTTATGATCCAATGTTATTCCCCC 60.295 42.308 0.00 0.00 0.00 5.40
1094 1668 2.186384 GCAGCAGCTCTCCGACAT 59.814 61.111 0.00 0.00 37.91 3.06
1755 2426 3.565902 ACAAGAACAAAACTAGCAGCCTC 59.434 43.478 0.00 0.00 0.00 4.70
1825 2496 3.644823 TCGTTAATCAGCAAACTCGTCA 58.355 40.909 0.00 0.00 0.00 4.35
1895 2566 6.747414 TCATTAGTAGAACAGCCCACATAT 57.253 37.500 0.00 0.00 0.00 1.78
1969 2672 3.713764 AGAATTCTCCCCACCAGATACAG 59.286 47.826 0.88 0.00 0.00 2.74
1996 2699 9.976255 ATGATCAAATAATCAAACAAATTTGCG 57.024 25.926 18.12 7.25 44.22 4.85
2030 2733 6.038714 GGAAGCTAGTATTCAAGTTGATTGGG 59.961 42.308 6.36 0.00 39.54 4.12
2038 2741 0.893727 AAGTTGATTGGGACACCGGC 60.894 55.000 0.00 0.00 39.29 6.13
2184 2889 7.455641 TTTAGGCAAATTTCCATTTCGTCTA 57.544 32.000 8.70 0.00 29.41 2.59
2288 2998 6.088173 ACACGAATGATTGACACAAATGATG 58.912 36.000 0.00 0.00 0.00 3.07
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
389 390 7.366847 AGAATCTTATTCCATCTCCGAGAAA 57.633 36.000 1.27 0.00 0.00 2.52
420 421 1.898472 CATCATCGGGACAGGAGCTAT 59.102 52.381 0.00 0.00 0.00 2.97
509 510 6.019961 CACACATGCATAAACAAACGAAAACT 60.020 34.615 0.00 0.00 0.00 2.66
512 513 5.344066 ACACACATGCATAAACAAACGAAA 58.656 33.333 0.00 0.00 0.00 3.46
568 569 0.958091 CAACAACCCTGCCGATGAAA 59.042 50.000 0.00 0.00 0.00 2.69
795 1008 5.563842 GGTATTCATTTTCTCAGCGAAGTG 58.436 41.667 0.00 0.00 32.21 3.16
1036 1251 0.987081 AGGAGGAGGAGCATGCACAT 60.987 55.000 21.98 12.04 0.00 3.21
1199 1773 2.980233 AGGTGCCAAGCTTGTCGC 60.980 61.111 24.35 20.75 39.57 5.19
1733 2404 3.555966 AGGCTGCTAGTTTTGTTCTTGT 58.444 40.909 0.00 0.00 0.00 3.16
1755 2426 3.057734 GTCACTTATTCCGCGGATAAGG 58.942 50.000 34.76 28.25 33.46 2.69
1994 2697 1.009829 CTAGCTTCCATGACAACCGC 58.990 55.000 0.00 0.00 0.00 5.68
1996 2699 5.428253 TGAATACTAGCTTCCATGACAACC 58.572 41.667 0.00 0.00 0.00 3.77
2030 2733 0.530870 GCTAGGAATGAGCCGGTGTC 60.531 60.000 1.90 0.33 33.60 3.67
2215 2921 9.099454 CAACAGAACTGAAGTATATCTAAACCC 57.901 37.037 8.87 0.00 0.00 4.11
2222 2932 8.779354 AGTTTCCAACAGAACTGAAGTATATC 57.221 34.615 8.87 0.00 32.95 1.63
2288 2998 7.659390 TCCATTACACAATTGGAAATTGGTTTC 59.341 33.333 10.83 0.00 42.39 2.78
2462 3172 2.347661 GCACAAAGAAACGACGTCTGAG 60.348 50.000 14.70 3.04 0.00 3.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.