Multiple sequence alignment - TraesCS6B01G429200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G429200 chr6B 100.000 3703 0 0 1 3703 697374315 697370613 0.000000e+00 6839.0
1 TraesCS6B01G429200 chr6B 98.354 3159 48 3 1 3157 697263221 697260065 0.000000e+00 5542.0
2 TraesCS6B01G429200 chr6B 98.291 3159 48 5 2 3157 697120296 697117141 0.000000e+00 5529.0
3 TraesCS6B01G429200 chr6B 97.766 3178 48 8 1 3157 697229285 697226110 0.000000e+00 5454.0
4 TraesCS6B01G429200 chr6B 97.210 896 22 3 1 895 697014830 697013937 0.000000e+00 1513.0
5 TraesCS6B01G429200 chr6B 92.977 954 43 10 2200 3132 696994663 696993713 0.000000e+00 1369.0
6 TraesCS6B01G429200 chr6B 97.449 784 18 2 1140 1921 696995437 696994654 0.000000e+00 1336.0
7 TraesCS6B01G429200 chr6B 89.692 1038 78 17 902 1921 697405616 697404590 0.000000e+00 1297.0
8 TraesCS6B01G429200 chr6B 86.172 998 72 28 2199 3132 697404600 697403605 0.000000e+00 1018.0
9 TraesCS6B01G429200 chr6B 96.715 548 11 2 3156 3703 697358854 697358314 0.000000e+00 905.0
10 TraesCS6B01G429200 chr6B 95.818 550 23 0 3154 3703 573861639 573862188 0.000000e+00 889.0
11 TraesCS6B01G429200 chr6B 95.620 548 23 1 3156 3703 219516538 219517084 0.000000e+00 878.0
12 TraesCS6B01G429200 chr6B 90.941 574 50 2 419 991 697263869 697263297 0.000000e+00 771.0
13 TraesCS6B01G429200 chr6B 90.767 574 52 1 419 991 697229934 697229361 0.000000e+00 765.0
14 TraesCS6B01G429200 chr6B 90.261 575 54 2 419 991 697234859 697234285 0.000000e+00 750.0
15 TraesCS6B01G429200 chr6B 90.244 574 55 1 419 991 697237077 697236504 0.000000e+00 749.0
16 TraesCS6B01G429200 chr6B 90.244 574 54 2 419 991 697239294 697238722 0.000000e+00 749.0
17 TraesCS6B01G429200 chr6B 90.972 432 36 3 1 432 697124936 697124508 2.480000e-161 579.0
18 TraesCS6B01G429200 chr6B 90.509 432 38 3 1 432 697231503 697231075 5.370000e-158 568.0
19 TraesCS6B01G429200 chr6B 90.509 432 38 3 1 432 697234209 697233781 5.370000e-158 568.0
20 TraesCS6B01G429200 chr6B 90.278 432 39 3 1 432 697236428 697236000 2.500000e-156 562.0
21 TraesCS6B01G429200 chr6B 90.278 432 39 3 1 432 697238646 697238218 2.500000e-156 562.0
22 TraesCS6B01G429200 chr6B 95.000 260 13 0 890 1149 697000906 697000647 3.440000e-110 409.0
23 TraesCS6B01G429200 chr6B 89.130 92 3 4 1997 2082 221814320 221814410 1.410000e-19 108.0
24 TraesCS6B01G429200 chr6D 92.513 1162 61 10 839 1988 458509037 458507890 0.000000e+00 1640.0
25 TraesCS6B01G429200 chr6D 89.922 1032 77 17 902 1922 458531154 458530139 0.000000e+00 1304.0
26 TraesCS6B01G429200 chr6D 87.881 1147 72 28 2074 3161 458507659 458506521 0.000000e+00 1286.0
27 TraesCS6B01G429200 chr6D 85.842 1003 69 30 2199 3132 458530151 458529153 0.000000e+00 998.0
28 TraesCS6B01G429200 chr6D 88.172 93 4 4 2001 2087 35022412 35022321 1.820000e-18 104.0
29 TraesCS6B01G429200 chr6A 89.961 1036 80 16 902 1921 605102418 605103445 0.000000e+00 1315.0
30 TraesCS6B01G429200 chr6A 88.229 943 76 13 2221 3128 605103460 605104402 0.000000e+00 1094.0
31 TraesCS6B01G429200 chr6A 85.000 80 12 0 2121 2200 54200538 54200459 8.520000e-12 82.4
32 TraesCS6B01G429200 chr6A 90.244 41 4 0 1960 2000 495506781 495506821 2.000000e-03 54.7
33 TraesCS6B01G429200 chr5B 97.445 548 13 1 3156 3703 521164282 521164828 0.000000e+00 933.0
34 TraesCS6B01G429200 chr5B 96.898 548 13 1 3156 3703 521176147 521176690 0.000000e+00 915.0
35 TraesCS6B01G429200 chr5B 77.863 131 17 6 1965 2083 702225458 702225588 1.850000e-08 71.3
36 TraesCS6B01G429200 chr4A 96.527 547 15 2 3158 3703 716252015 716251472 0.000000e+00 902.0
37 TraesCS6B01G429200 chr4A 83.133 83 8 2 2121 2197 626288381 626288463 1.850000e-08 71.3
38 TraesCS6B01G429200 chr2B 95.620 548 24 0 3156 3703 126713560 126713013 0.000000e+00 880.0
39 TraesCS6B01G429200 chr2B 95.487 554 17 4 3152 3703 773968263 773968810 0.000000e+00 878.0
40 TraesCS6B01G429200 chr2B 100.000 30 0 0 1969 1998 245689728 245689757 5.170000e-04 56.5
41 TraesCS6B01G429200 chr7B 95.455 550 25 0 3154 3703 572873880 572873331 0.000000e+00 878.0
42 TraesCS6B01G429200 chr7B 88.298 94 4 4 1999 2085 723211866 723211773 5.060000e-19 106.0
43 TraesCS6B01G429200 chr7B 88.298 94 4 4 1999 2085 723381115 723381022 5.060000e-19 106.0
44 TraesCS6B01G429200 chr7B 87.368 95 4 5 1999 2086 55863157 55863064 6.540000e-18 102.0
45 TraesCS6B01G429200 chr7B 90.566 53 5 0 2117 2169 608409413 608409465 1.850000e-08 71.3
46 TraesCS6B01G429200 chr7B 100.000 33 0 0 1966 1998 624756359 624756327 1.110000e-05 62.1
47 TraesCS6B01G429200 chr7D 83.090 822 121 14 1064 1878 20727930 20727120 0.000000e+00 732.0
48 TraesCS6B01G429200 chr7D 92.188 64 5 0 1 64 485983687 485983750 1.420000e-14 91.6
49 TraesCS6B01G429200 chr7D 82.692 104 10 4 1 96 256446699 256446596 6.590000e-13 86.1
50 TraesCS6B01G429200 chr3D 92.727 165 8 2 253 413 535459690 535459854 6.180000e-58 235.0
51 TraesCS6B01G429200 chr3D 83.168 101 9 4 1 93 15199375 15199475 6.590000e-13 86.1
52 TraesCS6B01G429200 chr1A 94.074 135 8 0 597 731 12762049 12761915 4.850000e-49 206.0
53 TraesCS6B01G429200 chr2D 89.041 146 12 2 272 413 566728574 566728719 1.060000e-40 178.0
54 TraesCS6B01G429200 chr1D 84.677 124 12 4 2078 2200 414276687 414276570 2.340000e-22 117.0
55 TraesCS6B01G429200 chr3B 85.437 103 7 5 1993 2088 48860716 48860817 2.350000e-17 100.0
56 TraesCS6B01G429200 chr3B 100.000 30 0 0 1969 1998 77007605 77007634 5.170000e-04 56.5
57 TraesCS6B01G429200 chr5D 93.651 63 4 0 2093 2155 497851531 497851593 1.090000e-15 95.3


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G429200 chr6B 697370613 697374315 3702 True 6839.000000 6839 100.000000 1 3703 1 chr6B.!!$R6 3702
1 TraesCS6B01G429200 chr6B 697117141 697120296 3155 True 5529.000000 5529 98.291000 2 3157 1 chr6B.!!$R3 3155
2 TraesCS6B01G429200 chr6B 697260065 697263869 3804 True 3156.500000 5542 94.647500 1 3157 2 chr6B.!!$R9 3156
3 TraesCS6B01G429200 chr6B 697013937 697014830 893 True 1513.000000 1513 97.210000 1 895 1 chr6B.!!$R2 894
4 TraesCS6B01G429200 chr6B 696993713 696995437 1724 True 1352.500000 1369 95.213000 1140 3132 2 chr6B.!!$R7 1992
5 TraesCS6B01G429200 chr6B 697226110 697239294 13184 True 1191.888889 5454 91.206222 1 3157 9 chr6B.!!$R8 3156
6 TraesCS6B01G429200 chr6B 697403605 697405616 2011 True 1157.500000 1297 87.932000 902 3132 2 chr6B.!!$R10 2230
7 TraesCS6B01G429200 chr6B 697358314 697358854 540 True 905.000000 905 96.715000 3156 3703 1 chr6B.!!$R5 547
8 TraesCS6B01G429200 chr6B 573861639 573862188 549 False 889.000000 889 95.818000 3154 3703 1 chr6B.!!$F3 549
9 TraesCS6B01G429200 chr6B 219516538 219517084 546 False 878.000000 878 95.620000 3156 3703 1 chr6B.!!$F1 547
10 TraesCS6B01G429200 chr6D 458506521 458509037 2516 True 1463.000000 1640 90.197000 839 3161 2 chr6D.!!$R2 2322
11 TraesCS6B01G429200 chr6D 458529153 458531154 2001 True 1151.000000 1304 87.882000 902 3132 2 chr6D.!!$R3 2230
12 TraesCS6B01G429200 chr6A 605102418 605104402 1984 False 1204.500000 1315 89.095000 902 3128 2 chr6A.!!$F2 2226
13 TraesCS6B01G429200 chr5B 521164282 521164828 546 False 933.000000 933 97.445000 3156 3703 1 chr5B.!!$F1 547
14 TraesCS6B01G429200 chr5B 521176147 521176690 543 False 915.000000 915 96.898000 3156 3703 1 chr5B.!!$F2 547
15 TraesCS6B01G429200 chr4A 716251472 716252015 543 True 902.000000 902 96.527000 3158 3703 1 chr4A.!!$R1 545
16 TraesCS6B01G429200 chr2B 126713013 126713560 547 True 880.000000 880 95.620000 3156 3703 1 chr2B.!!$R1 547
17 TraesCS6B01G429200 chr2B 773968263 773968810 547 False 878.000000 878 95.487000 3152 3703 1 chr2B.!!$F2 551
18 TraesCS6B01G429200 chr7B 572873331 572873880 549 True 878.000000 878 95.455000 3154 3703 1 chr7B.!!$R2 549
19 TraesCS6B01G429200 chr7D 20727120 20727930 810 True 732.000000 732 83.090000 1064 1878 1 chr7D.!!$R1 814

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
845 10875 0.536460 TGCCTCCTTTCCGTTTCCAC 60.536 55.0 0.0 0.0 0.0 4.02 F
1042 11101 0.655733 GCACAACACGTACAGCACTT 59.344 50.0 0.0 0.0 0.0 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1960 12045 7.119553 CGGAGGGAGTACTATATTACTTGACTC 59.880 44.444 0.0 10.77 32.17 3.36 R
3094 13433 8.669243 GGAATCAGTCAATGAAAGTAGTTAAGG 58.331 37.037 0.0 0.00 42.53 2.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
348 10358 3.655358 CCATGGGGGTACGTCCAT 58.345 61.111 2.85 11.44 42.17 3.41
845 10875 0.536460 TGCCTCCTTTCCGTTTCCAC 60.536 55.000 0.00 0.00 0.00 4.02
944 10974 0.762418 TGGTCATCACCCTCGTGTTT 59.238 50.000 0.00 0.00 42.99 2.83
964 11000 3.878086 TCACGAGAAATGACAGCAAAC 57.122 42.857 0.00 0.00 0.00 2.93
965 11001 3.202097 TCACGAGAAATGACAGCAAACA 58.798 40.909 0.00 0.00 0.00 2.83
1006 11054 2.169330 GTGTCCTCCGTCCCCTATATC 58.831 57.143 0.00 0.00 0.00 1.63
1042 11101 0.655733 GCACAACACGTACAGCACTT 59.344 50.000 0.00 0.00 0.00 3.16
1458 11521 2.044650 TACTACGTGGAGGCGGCT 60.045 61.111 13.09 13.09 35.98 5.52
1938 12023 2.951229 AAGGGTGTGGTTAGGTCTTG 57.049 50.000 0.00 0.00 0.00 3.02
2068 12241 7.680442 TTCATTTCATGACAAGTATTTCCGA 57.320 32.000 0.00 0.00 39.39 4.55
3094 13433 6.828785 ACATATGGACCCTATCAAGTCAAAAC 59.171 38.462 7.80 0.00 34.58 2.43
3407 13748 6.586344 ACAGACTGAAGAAATTGAACTGAGA 58.414 36.000 10.08 0.00 0.00 3.27
3525 13867 5.556915 CCAGTTAGGTTGGTGAAGACAATA 58.443 41.667 0.00 0.00 0.00 1.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
93 10103 6.525578 AGTCTTGGTTGATTATCACGAGTA 57.474 37.500 0.00 0.00 0.00 2.59
180 10190 3.884091 ACGTCGTCCTATTCAGAGCTTAT 59.116 43.478 0.00 0.00 0.00 1.73
341 10351 1.227704 TCGTGTTTGCCATGGACGT 60.228 52.632 18.40 0.00 0.00 4.34
845 10875 2.031516 CAAGACTGCTCGCTGTGGG 61.032 63.158 6.15 0.00 0.00 4.61
906 10936 5.710099 TGACCATGACACTATATCGCTATCA 59.290 40.000 0.00 0.00 0.00 2.15
944 10974 3.002246 GTGTTTGCTGTCATTTCTCGTGA 59.998 43.478 0.00 0.00 0.00 4.35
1006 11054 2.164422 TGTGCACTTCGATCTGGTAGAG 59.836 50.000 19.41 0.00 0.00 2.43
1042 11101 5.359292 CCATTGCCGATGATCTCTATCTCTA 59.641 44.000 0.00 0.00 38.03 2.43
1458 11521 3.479203 CAGTCCGCCAGCCCCATA 61.479 66.667 0.00 0.00 0.00 2.74
1960 12045 7.119553 CGGAGGGAGTACTATATTACTTGACTC 59.880 44.444 0.00 10.77 32.17 3.36
3094 13433 8.669243 GGAATCAGTCAATGAAAGTAGTTAAGG 58.331 37.037 0.00 0.00 42.53 2.69
3407 13748 9.620259 ACTTTGACTGAAGACTTTCTCTATTTT 57.380 29.630 0.00 0.00 34.31 1.82
3412 13753 6.478512 AGACTTTGACTGAAGACTTTCTCT 57.521 37.500 0.00 0.00 34.31 3.10
3525 13867 5.061721 AGTTGGAACTGGTCTACCAAATT 57.938 39.130 2.97 0.88 46.97 1.82
3549 13891 2.691526 ACCAGACGTACAACTGAGACAA 59.308 45.455 15.06 0.00 36.38 3.18
3612 13954 0.394565 GTGCTCAGAGACTGGGTGTT 59.605 55.000 0.00 0.00 33.88 3.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.