Multiple sequence alignment - TraesCS6B01G426500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G426500 chr6B 100.000 2864 0 0 1 2864 694680464 694683327 0.000000e+00 5289.0
1 TraesCS6B01G426500 chr7B 96.706 2277 42 8 593 2864 587101600 587103848 0.000000e+00 3759.0
2 TraesCS6B01G426500 chr7B 96.441 2276 40 14 593 2864 587266816 587269054 0.000000e+00 3716.0
3 TraesCS6B01G426500 chr7B 95.533 1500 53 6 591 2076 587479500 587480999 0.000000e+00 2386.0
4 TraesCS6B01G426500 chr7B 95.115 1351 46 3 591 1935 587518761 587520097 0.000000e+00 2111.0
5 TraesCS6B01G426500 chr7B 97.235 1121 28 3 752 1869 587440662 587441782 0.000000e+00 1895.0
6 TraesCS6B01G426500 chr7B 94.718 833 23 3 1427 2250 587620573 587621393 0.000000e+00 1275.0
7 TraesCS6B01G426500 chr7B 96.757 740 21 3 2125 2862 587520088 587520826 0.000000e+00 1230.0
8 TraesCS6B01G426500 chr7B 97.682 647 15 0 788 1434 587615231 587615877 0.000000e+00 1112.0
9 TraesCS6B01G426500 chr7B 93.376 619 17 11 2094 2707 587441940 587442539 0.000000e+00 894.0
10 TraesCS6B01G426500 chr7B 87.297 677 63 11 1 655 569440639 569439964 0.000000e+00 752.0
11 TraesCS6B01G426500 chr7B 97.049 305 5 3 2094 2395 587480986 587481289 7.080000e-141 510.0
12 TraesCS6B01G426500 chr7B 88.615 325 14 8 2388 2707 587481560 587481866 9.690000e-100 374.0
13 TraesCS6B01G426500 chr7B 91.102 236 21 0 494 729 587464293 587464528 1.280000e-83 320.0
14 TraesCS6B01G426500 chr7B 96.250 160 5 1 2705 2864 587442620 587442778 7.870000e-66 261.0
15 TraesCS6B01G426500 chr7B 96.250 160 5 1 2705 2864 587481947 587482105 7.870000e-66 261.0
16 TraesCS6B01G426500 chr7B 94.667 150 3 1 1904 2048 587441782 587441931 7.980000e-56 228.0
17 TraesCS6B01G426500 chr7B 85.714 154 12 2 2311 2455 587635764 587635916 1.370000e-33 154.0
18 TraesCS6B01G426500 chr7B 96.667 90 3 0 2233 2322 587635354 587635443 1.780000e-32 150.0
19 TraesCS6B01G426500 chr7B 93.269 104 4 2 2714 2815 587653122 587653224 1.780000e-32 150.0
20 TraesCS6B01G426500 chr7B 88.710 62 3 3 2263 2322 587635687 587635746 3.960000e-09 73.1
21 TraesCS6B01G426500 chr7A 93.754 1761 97 9 1 1757 625641669 625643420 0.000000e+00 2630.0
22 TraesCS6B01G426500 chr7A 92.119 1789 95 19 1 1757 625674442 625676216 0.000000e+00 2481.0
23 TraesCS6B01G426500 chr7A 85.049 709 80 18 1 705 631653224 631652538 0.000000e+00 699.0
24 TraesCS6B01G426500 chr7A 85.085 295 37 3 418 705 617552301 617552007 7.760000e-76 294.0
25 TraesCS6B01G426500 chr1D 90.774 1485 84 20 1 1447 110904659 110906128 0.000000e+00 1934.0
26 TraesCS6B01G426500 chr7D 93.835 957 39 5 991 1947 543731878 543732814 0.000000e+00 1423.0
27 TraesCS6B01G426500 chr7D 91.897 975 50 14 1 946 543730902 543731876 0.000000e+00 1336.0
28 TraesCS6B01G426500 chr7D 84.375 672 94 5 1 666 548550440 548551106 0.000000e+00 649.0
29 TraesCS6B01G426500 chr7D 85.417 288 27 11 2043 2322 543732833 543733113 4.670000e-73 285.0
30 TraesCS6B01G426500 chr7D 86.220 254 20 8 2311 2555 543733131 543733378 7.870000e-66 261.0
31 TraesCS6B01G426500 chr7D 92.857 126 7 1 2690 2815 543733374 543733497 6.300000e-42 182.0
32 TraesCS6B01G426500 chr1B 90.665 932 48 20 1 907 169024443 169025360 0.000000e+00 1203.0
33 TraesCS6B01G426500 chr4B 85.536 560 64 10 1 554 527592886 527593434 1.150000e-158 569.0
34 TraesCS6B01G426500 chr2A 81.693 437 44 14 534 941 701783101 701782672 5.910000e-87 331.0
35 TraesCS6B01G426500 chr4D 85.897 78 8 3 2594 2669 333874191 333874267 2.370000e-11 80.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G426500 chr6B 694680464 694683327 2863 False 5289.00 5289 100.00000 1 2864 1 chr6B.!!$F1 2863
1 TraesCS6B01G426500 chr7B 587101600 587103848 2248 False 3759.00 3759 96.70600 593 2864 1 chr7B.!!$F1 2271
2 TraesCS6B01G426500 chr7B 587266816 587269054 2238 False 3716.00 3716 96.44100 593 2864 1 chr7B.!!$F2 2271
3 TraesCS6B01G426500 chr7B 587518761 587520826 2065 False 1670.50 2111 95.93600 591 2862 2 chr7B.!!$F9 2271
4 TraesCS6B01G426500 chr7B 587620573 587621393 820 False 1275.00 1275 94.71800 1427 2250 1 chr7B.!!$F5 823
5 TraesCS6B01G426500 chr7B 587615231 587615877 646 False 1112.00 1112 97.68200 788 1434 1 chr7B.!!$F4 646
6 TraesCS6B01G426500 chr7B 587479500 587482105 2605 False 882.75 2386 94.36175 591 2864 4 chr7B.!!$F8 2273
7 TraesCS6B01G426500 chr7B 587440662 587442778 2116 False 819.50 1895 95.38200 752 2864 4 chr7B.!!$F7 2112
8 TraesCS6B01G426500 chr7B 569439964 569440639 675 True 752.00 752 87.29700 1 655 1 chr7B.!!$R1 654
9 TraesCS6B01G426500 chr7A 625641669 625643420 1751 False 2630.00 2630 93.75400 1 1757 1 chr7A.!!$F1 1756
10 TraesCS6B01G426500 chr7A 625674442 625676216 1774 False 2481.00 2481 92.11900 1 1757 1 chr7A.!!$F2 1756
11 TraesCS6B01G426500 chr7A 631652538 631653224 686 True 699.00 699 85.04900 1 705 1 chr7A.!!$R2 704
12 TraesCS6B01G426500 chr1D 110904659 110906128 1469 False 1934.00 1934 90.77400 1 1447 1 chr1D.!!$F1 1446
13 TraesCS6B01G426500 chr7D 543730902 543733497 2595 False 697.40 1423 90.04520 1 2815 5 chr7D.!!$F2 2814
14 TraesCS6B01G426500 chr7D 548550440 548551106 666 False 649.00 649 84.37500 1 666 1 chr7D.!!$F1 665
15 TraesCS6B01G426500 chr1B 169024443 169025360 917 False 1203.00 1203 90.66500 1 907 1 chr1B.!!$F1 906
16 TraesCS6B01G426500 chr4B 527592886 527593434 548 False 569.00 569 85.53600 1 554 1 chr4B.!!$F1 553

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
873 932 0.165944 CGAATGTCACTCGGTTTGCC 59.834 55.0 0.0 0.0 32.62 4.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2501 2946 7.901377 GGTACGTACAACAAAACATTATGCTAG 59.099 37.037 26.02 0.0 0.0 3.42 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
601 633 1.642952 GCGTCGGTTCGTAGTCCTCT 61.643 60.000 0.00 0.0 0.00 3.69
617 649 4.827087 CTGTGCTCCCGATGCGCT 62.827 66.667 9.73 0.0 41.05 5.92
779 825 2.749044 AGGAGCGGCACATGCAAG 60.749 61.111 6.15 0.0 44.36 4.01
852 898 0.967380 TCCGACTGCTGCTCTGATCA 60.967 55.000 0.00 0.0 0.00 2.92
873 932 0.165944 CGAATGTCACTCGGTTTGCC 59.834 55.000 0.00 0.0 32.62 4.52
2501 2946 2.500229 TCACACCGAAATTTGGGAGTC 58.500 47.619 24.27 0.0 28.34 3.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
184 185 2.350895 CACCGGGACATCAAGCCA 59.649 61.111 6.32 0.0 0.00 4.75
238 248 2.894387 GTCATGCGGCAGCTCCTC 60.894 66.667 10.92 0.0 45.42 3.71
587 619 0.889306 AGCACAGAGGACTACGAACC 59.111 55.000 0.00 0.0 0.00 3.62
589 621 1.174783 GGAGCACAGAGGACTACGAA 58.825 55.000 0.00 0.0 0.00 3.85
617 649 4.069232 CGGCTCCCGCAAGAGACA 62.069 66.667 6.64 0.0 42.54 3.41
779 825 1.429148 ATCTTCGAACGGCAATCGGC 61.429 55.000 8.76 0.0 44.45 5.54
852 898 1.263217 GCAAACCGAGTGACATTCGTT 59.737 47.619 17.65 10.0 36.37 3.85
873 932 4.760047 CTTCCGGTGAGGCGGTGG 62.760 72.222 0.00 0.0 40.77 4.61
2501 2946 7.901377 GGTACGTACAACAAAACATTATGCTAG 59.099 37.037 26.02 0.0 0.00 3.42


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.