Multiple sequence alignment - TraesCS6B01G403500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G403500 chr6B 100.000 2264 0 0 1 2264 679251632 679253895 0.000000e+00 4181
1 TraesCS6B01G403500 chr6B 97.516 1771 44 0 1 1771 181111563 181109793 0.000000e+00 3027
2 TraesCS6B01G403500 chr6B 93.316 389 24 2 1753 2140 599877889 599878276 7.010000e-160 573
3 TraesCS6B01G403500 chr2B 98.101 2264 42 1 1 2264 68145332 68147594 0.000000e+00 3941
4 TraesCS6B01G403500 chr2B 98.470 1765 27 0 1 1765 549352846 549354610 0.000000e+00 3110
5 TraesCS6B01G403500 chr2B 97.564 1765 42 1 1 1765 454449226 454450989 0.000000e+00 3020
6 TraesCS6B01G403500 chr2B 92.891 422 27 3 1753 2172 549354634 549355054 5.350000e-171 610
7 TraesCS6B01G403500 chr2B 93.350 391 25 1 1874 2264 549354873 549355262 5.420000e-161 577
8 TraesCS6B01G403500 chr3B 95.402 2175 81 8 1 2162 558278372 558276204 0.000000e+00 3445
9 TraesCS6B01G403500 chr3B 97.741 1771 40 0 1 1771 604266042 604264272 0.000000e+00 3049
10 TraesCS6B01G403500 chr3B 95.938 517 16 2 1753 2264 604264254 604263738 0.000000e+00 833
11 TraesCS6B01G403500 chr3B 93.103 116 8 0 2127 2242 420918900 420918785 1.080000e-38 171
12 TraesCS6B01G403500 chr3B 86.667 135 16 2 2109 2242 760825774 760825907 5.040000e-32 148
13 TraesCS6B01G403500 chr1B 97.798 1771 39 0 1 1771 571422403 571420633 0.000000e+00 3055
14 TraesCS6B01G403500 chr4B 97.790 1765 34 3 1 1765 551060038 551061797 0.000000e+00 3038
15 TraesCS6B01G403500 chr4B 94.152 513 28 2 1753 2264 310257947 310258458 0.000000e+00 780
16 TraesCS6B01G403500 chr5B 97.734 1765 38 1 1 1765 506965544 506967306 0.000000e+00 3037
17 TraesCS6B01G403500 chr5B 92.802 514 35 2 1753 2264 234883817 234883304 0.000000e+00 743
18 TraesCS6B01G403500 chr5B 93.365 422 25 3 1753 2172 584815141 584814721 2.470000e-174 621
19 TraesCS6B01G403500 chr5B 89.117 487 47 5 1760 2242 709184994 709184510 3.220000e-168 601
20 TraesCS6B01G403500 chr5B 97.554 327 7 1 1694 2020 701831696 701831371 1.960000e-155 558
21 TraesCS6B01G403500 chr5B 93.478 138 7 2 2127 2264 701831218 701831083 1.060000e-48 204


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G403500 chr6B 679251632 679253895 2263 False 4181.000000 4181 100.000000 1 2264 1 chr6B.!!$F2 2263
1 TraesCS6B01G403500 chr6B 181109793 181111563 1770 True 3027.000000 3027 97.516000 1 1771 1 chr6B.!!$R1 1770
2 TraesCS6B01G403500 chr2B 68145332 68147594 2262 False 3941.000000 3941 98.101000 1 2264 1 chr2B.!!$F1 2263
3 TraesCS6B01G403500 chr2B 454449226 454450989 1763 False 3020.000000 3020 97.564000 1 1765 1 chr2B.!!$F2 1764
4 TraesCS6B01G403500 chr2B 549352846 549355262 2416 False 1432.333333 3110 94.903667 1 2264 3 chr2B.!!$F3 2263
5 TraesCS6B01G403500 chr3B 558276204 558278372 2168 True 3445.000000 3445 95.402000 1 2162 1 chr3B.!!$R2 2161
6 TraesCS6B01G403500 chr3B 604263738 604266042 2304 True 1941.000000 3049 96.839500 1 2264 2 chr3B.!!$R3 2263
7 TraesCS6B01G403500 chr1B 571420633 571422403 1770 True 3055.000000 3055 97.798000 1 1771 1 chr1B.!!$R1 1770
8 TraesCS6B01G403500 chr4B 551060038 551061797 1759 False 3038.000000 3038 97.790000 1 1765 1 chr4B.!!$F2 1764
9 TraesCS6B01G403500 chr4B 310257947 310258458 511 False 780.000000 780 94.152000 1753 2264 1 chr4B.!!$F1 511
10 TraesCS6B01G403500 chr5B 506965544 506967306 1762 False 3037.000000 3037 97.734000 1 1765 1 chr5B.!!$F1 1764
11 TraesCS6B01G403500 chr5B 234883304 234883817 513 True 743.000000 743 92.802000 1753 2264 1 chr5B.!!$R1 511
12 TraesCS6B01G403500 chr5B 701831083 701831696 613 True 381.000000 558 95.516000 1694 2264 2 chr5B.!!$R4 570

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
203 204 0.620556 AGGGACGGTAGGTCTTACGA 59.379 55.0 0.0 0.0 45.35 3.43 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1713 1714 0.238289 CAAGTTGACGACACATGGCC 59.762 55.0 0.0 0.0 0.0 5.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
203 204 0.620556 AGGGACGGTAGGTCTTACGA 59.379 55.000 0.00 0.00 45.35 3.43
457 458 0.994247 AGACATTGTGCCAGATCCCA 59.006 50.000 0.00 0.00 0.00 4.37
523 524 3.321968 CCGGAGTGACATGGATGATCTAA 59.678 47.826 0.00 0.00 0.00 2.10
1011 1012 1.216064 TGTAGGGCATGGCTTCATCT 58.784 50.000 19.78 9.59 0.00 2.90
1596 1597 0.689080 AGGAGGATGAGGCACGTGAT 60.689 55.000 22.23 6.57 0.00 3.06
1644 1645 1.019805 AGTAAAGCCTTCGCCTTCGC 61.020 55.000 0.00 0.00 34.57 4.70
1713 1714 8.997621 TGAACTATGTAGTACTAAGGCAAAAG 57.002 34.615 3.61 4.19 34.99 2.27
2190 2440 0.560688 GATCTGGTCCCTCCTCTCCT 59.439 60.000 0.00 0.00 37.07 3.69
2254 2504 4.524749 CAATTCTATCTCGCAAGCACATG 58.475 43.478 0.00 0.00 37.18 3.21
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
203 204 1.676014 GCACCTCGTAAGCAACTCCAT 60.676 52.381 0.00 0.00 37.18 3.41
523 524 3.264193 TGCTTCATTCCAGTGTATCCAGT 59.736 43.478 0.00 0.00 0.00 4.00
704 705 4.111577 TCCAATGTTAGTCCTTCCTCCAT 58.888 43.478 0.00 0.00 0.00 3.41
1011 1012 0.539438 GTGGCCTTGTCATGGAACCA 60.539 55.000 3.32 4.72 0.00 3.67
1269 1270 5.741425 CACACAGTTGAGAGTAACATGTTG 58.259 41.667 21.42 3.33 32.92 3.33
1644 1645 1.469251 CCGGTTACATGACGAGTCCAG 60.469 57.143 0.00 0.00 0.00 3.86
1713 1714 0.238289 CAAGTTGACGACACATGGCC 59.762 55.000 0.00 0.00 0.00 5.36
1987 2237 1.537889 CCTGTGGTGGTAGGGTCCA 60.538 63.158 0.00 0.00 34.85 4.02
2190 2440 4.133820 CGACACATATGGGGCAAAATAGA 58.866 43.478 12.35 0.00 0.00 1.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.