Multiple sequence alignment - TraesCS6B01G391700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G391700 chr6B 100.000 2738 0 0 1 2738 666306302 666309039 0.000000e+00 5057
1 TraesCS6B01G391700 chr6B 99.708 2738 8 0 1 2738 666274177 666276914 0.000000e+00 5012
2 TraesCS6B01G391700 chr6B 95.077 2194 65 21 1 2168 666219080 666221256 0.000000e+00 3413
3 TraesCS6B01G391700 chr6B 91.817 1332 77 16 855 2168 666176384 666177701 0.000000e+00 1827
4 TraesCS6B01G391700 chr6B 94.082 828 28 6 1 819 666175568 666176383 0.000000e+00 1238
5 TraesCS6B01G391700 chr6B 91.755 752 62 0 512 1263 666054647 666055398 0.000000e+00 1046
6 TraesCS6B01G391700 chr6B 82.852 1073 121 31 1114 2168 666092774 666093801 0.000000e+00 904
7 TraesCS6B01G391700 chr6B 83.066 685 105 9 260 937 666051195 666051875 1.800000e-171 612
8 TraesCS6B01G391700 chr6B 86.222 450 49 7 2173 2610 666177491 666177939 2.470000e-130 475
9 TraesCS6B01G391700 chr6B 85.556 450 52 9 2173 2610 666221046 666221494 2.480000e-125 459
10 TraesCS6B01G391700 chrUn 99.884 1731 2 0 1008 2738 349101538 349099808 0.000000e+00 3186
11 TraesCS6B01G391700 chr6A 87.006 2178 228 27 11 2168 589174364 589176506 0.000000e+00 2403
12 TraesCS6B01G391700 chr6A 86.351 2176 232 31 11 2168 589193300 589191172 0.000000e+00 2313
13 TraesCS6B01G391700 chr6A 89.576 566 52 4 2179 2738 589191374 589190810 0.000000e+00 712
14 TraesCS6B01G391700 chr6A 89.223 566 54 4 2179 2738 589176305 589176869 0.000000e+00 701
15 TraesCS6B01G391700 chr6A 88.889 126 10 3 2613 2738 589089490 589089611 4.720000e-33 152
16 TraesCS6B01G391700 chr6A 88.889 126 10 3 2613 2738 589130604 589130725 4.720000e-33 152
17 TraesCS6B01G391700 chr6D 85.910 2186 250 33 1 2167 441315873 441318019 0.000000e+00 2278
18 TraesCS6B01G391700 chr6D 86.705 2106 213 35 102 2167 441396803 441398881 0.000000e+00 2276
19 TraesCS6B01G391700 chr6D 86.700 2000 208 28 2 1980 441290385 441292347 0.000000e+00 2167
20 TraesCS6B01G391700 chr6D 84.722 1080 117 29 1128 2166 441100603 441101675 0.000000e+00 1037
21 TraesCS6B01G391700 chr6D 88.947 570 47 6 2175 2738 441398676 441399235 0.000000e+00 689
22 TraesCS6B01G391700 chr6D 90.693 505 40 4 2240 2738 441292348 441292851 0.000000e+00 665
23 TraesCS6B01G391700 chr6D 90.029 341 28 3 2180 2514 441292904 441293244 1.160000e-118 436
24 TraesCS6B01G391700 chr6D 88.372 344 34 3 2175 2512 441101472 441101815 2.540000e-110 409
25 TraesCS6B01G391700 chr6D 91.379 232 20 0 2507 2738 441325679 441325910 4.400000e-83 318
26 TraesCS6B01G391700 chr6D 91.089 101 9 0 162 262 441316127 441316227 1.320000e-28 137
27 TraesCS6B01G391700 chr7A 77.658 837 153 16 913 1745 731236494 731237300 1.910000e-131 479


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G391700 chr6B 666306302 666309039 2737 False 5057.000000 5057 100.000000 1 2738 1 chr6B.!!$F3 2737
1 TraesCS6B01G391700 chr6B 666274177 666276914 2737 False 5012.000000 5012 99.708000 1 2738 1 chr6B.!!$F2 2737
2 TraesCS6B01G391700 chr6B 666219080 666221494 2414 False 1936.000000 3413 90.316500 1 2610 2 chr6B.!!$F6 2609
3 TraesCS6B01G391700 chr6B 666175568 666177939 2371 False 1180.000000 1827 90.707000 1 2610 3 chr6B.!!$F5 2609
4 TraesCS6B01G391700 chr6B 666092774 666093801 1027 False 904.000000 904 82.852000 1114 2168 1 chr6B.!!$F1 1054
5 TraesCS6B01G391700 chr6B 666051195 666055398 4203 False 829.000000 1046 87.410500 260 1263 2 chr6B.!!$F4 1003
6 TraesCS6B01G391700 chrUn 349099808 349101538 1730 True 3186.000000 3186 99.884000 1008 2738 1 chrUn.!!$R1 1730
7 TraesCS6B01G391700 chr6A 589174364 589176869 2505 False 1552.000000 2403 88.114500 11 2738 2 chr6A.!!$F3 2727
8 TraesCS6B01G391700 chr6A 589190810 589193300 2490 True 1512.500000 2313 87.963500 11 2738 2 chr6A.!!$R1 2727
9 TraesCS6B01G391700 chr6D 441396803 441399235 2432 False 1482.500000 2276 87.826000 102 2738 2 chr6D.!!$F5 2636
10 TraesCS6B01G391700 chr6D 441315873 441318019 2146 False 1207.500000 2278 88.499500 1 2167 2 chr6D.!!$F4 2166
11 TraesCS6B01G391700 chr6D 441290385 441293244 2859 False 1089.333333 2167 89.140667 2 2738 3 chr6D.!!$F3 2736
12 TraesCS6B01G391700 chr6D 441100603 441101815 1212 False 723.000000 1037 86.547000 1128 2512 2 chr6D.!!$F2 1384
13 TraesCS6B01G391700 chr7A 731236494 731237300 806 False 479.000000 479 77.658000 913 1745 1 chr7A.!!$F1 832

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
572 3806 8.189119 TGCTGGTTAATAATGTCTTCCTTTTT 57.811 30.769 0.0 0.0 0.0 1.94 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2088 5389 3.403057 CGGCCAACACACGAGACG 61.403 66.667 2.24 0.0 0.0 4.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
572 3806 8.189119 TGCTGGTTAATAATGTCTTCCTTTTT 57.811 30.769 0.00 0.00 0.00 1.94
1006 4242 2.198336 TCCCTTTACCGGAAATGGCTA 58.802 47.619 9.46 0.00 33.88 3.93
2088 5389 3.017442 GTCAGGGCCTGAAATAACCTTC 58.983 50.000 36.54 17.62 42.46 3.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
271 280 6.850752 TGAGTTGTAGGAGAACATATGACA 57.149 37.500 10.38 0.0 0.0 3.58
572 3806 3.512329 TCGGTTGCTCCTATCTAACACAA 59.488 43.478 0.00 0.0 0.0 3.33
1006 4242 0.037326 TTGCGGATCGACTTCTTGCT 60.037 50.000 0.00 0.0 0.0 3.91
2088 5389 3.403057 CGGCCAACACACGAGACG 61.403 66.667 2.24 0.0 0.0 4.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.