Multiple sequence alignment - TraesCS6B01G385700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G385700 chr6B 100.000 2549 0 0 1 2549 660438315 660435767 0.000000e+00 4708
1 TraesCS6B01G385700 chr6B 97.906 573 12 0 1 573 660296772 660296200 0.000000e+00 992
2 TraesCS6B01G385700 chr6B 97.906 573 12 0 1 573 660375923 660375351 0.000000e+00 992
3 TraesCS6B01G385700 chr6B 96.859 573 18 0 1 573 660343113 660342541 0.000000e+00 959
4 TraesCS6B01G385700 chr7A 99.040 1979 17 2 573 2549 701581941 701583919 0.000000e+00 3548
5 TraesCS6B01G385700 chr6A 99.137 1970 14 3 571 2538 617222871 617220903 0.000000e+00 3541
6 TraesCS6B01G385700 chr6A 94.845 97 5 0 1 97 585002947 585002851 4.390000e-33 152
7 TraesCS6B01G385700 chr3B 98.939 1980 19 2 571 2549 379294091 379296069 0.000000e+00 3539
8 TraesCS6B01G385700 chr5A 98.939 1979 18 3 573 2549 459744881 459746858 0.000000e+00 3535
9 TraesCS6B01G385700 chr7B 98.889 1980 19 3 573 2549 552932143 552930164 0.000000e+00 3531
10 TraesCS6B01G385700 chr7B 98.594 1992 26 2 560 2549 1776644 1774653 0.000000e+00 3522
11 TraesCS6B01G385700 chr7B 98.787 1978 22 2 573 2549 552850598 552852574 0.000000e+00 3518
12 TraesCS6B01G385700 chr1A 98.888 1979 19 3 572 2549 22791528 22793504 0.000000e+00 3530
13 TraesCS6B01G385700 chr2B 98.740 1984 21 3 569 2549 4739872 4741854 0.000000e+00 3522
14 TraesCS6B01G385700 chr5B 85.813 289 40 1 1 289 646674235 646674522 3.190000e-79 305
15 TraesCS6B01G385700 chr5D 82.712 295 49 2 1 295 514558220 514558512 6.990000e-66 261


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G385700 chr6B 660435767 660438315 2548 True 4708 4708 100.000 1 2549 1 chr6B.!!$R4 2548
1 TraesCS6B01G385700 chr6B 660296200 660296772 572 True 992 992 97.906 1 573 1 chr6B.!!$R1 572
2 TraesCS6B01G385700 chr6B 660375351 660375923 572 True 992 992 97.906 1 573 1 chr6B.!!$R3 572
3 TraesCS6B01G385700 chr6B 660342541 660343113 572 True 959 959 96.859 1 573 1 chr6B.!!$R2 572
4 TraesCS6B01G385700 chr7A 701581941 701583919 1978 False 3548 3548 99.040 573 2549 1 chr7A.!!$F1 1976
5 TraesCS6B01G385700 chr6A 617220903 617222871 1968 True 3541 3541 99.137 571 2538 1 chr6A.!!$R2 1967
6 TraesCS6B01G385700 chr3B 379294091 379296069 1978 False 3539 3539 98.939 571 2549 1 chr3B.!!$F1 1978
7 TraesCS6B01G385700 chr5A 459744881 459746858 1977 False 3535 3535 98.939 573 2549 1 chr5A.!!$F1 1976
8 TraesCS6B01G385700 chr7B 552930164 552932143 1979 True 3531 3531 98.889 573 2549 1 chr7B.!!$R2 1976
9 TraesCS6B01G385700 chr7B 1774653 1776644 1991 True 3522 3522 98.594 560 2549 1 chr7B.!!$R1 1989
10 TraesCS6B01G385700 chr7B 552850598 552852574 1976 False 3518 3518 98.787 573 2549 1 chr7B.!!$F1 1976
11 TraesCS6B01G385700 chr1A 22791528 22793504 1976 False 3530 3530 98.888 572 2549 1 chr1A.!!$F1 1977
12 TraesCS6B01G385700 chr2B 4739872 4741854 1982 False 3522 3522 98.740 569 2549 1 chr2B.!!$F1 1980

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
992 995 0.325671 TTGAGATCCCCTTCGGCTCT 60.326 55.0 0.0 0.0 0.0 4.09 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1813 1960 2.475339 ATGGGCCTTATTGGATGCAA 57.525 45.0 4.53 0.79 38.35 4.08 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
100 101 7.446625 AGGTCATCTCTATATCAAAATTGCCAC 59.553 37.037 0.00 0.00 0.00 5.01
414 415 5.188948 TGAAGGAAAATGAATCGGGAGTCTA 59.811 40.000 0.00 0.00 0.00 2.59
515 516 4.447054 CAGATCCGCATCATGTTCTACTTC 59.553 45.833 0.00 0.00 0.00 3.01
910 913 2.403378 GCGAGAGAGAGAGCACGGT 61.403 63.158 0.00 0.00 0.00 4.83
992 995 0.325671 TTGAGATCCCCTTCGGCTCT 60.326 55.000 0.00 0.00 0.00 4.09
1813 1960 2.107204 CAGGCTAGACTAATGGGCCAAT 59.893 50.000 11.89 4.19 44.60 3.16
1824 1971 2.171568 TGGGCCAATTGCATCCAATA 57.828 45.000 2.13 0.00 40.69 1.90
2281 2447 7.943447 GGAAGGAAGGTATACATAGTGAGACTA 59.057 40.741 5.01 0.00 34.82 2.59
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
9 10 1.137697 GGATCCAAGTTACCCGGGAT 58.862 55.000 32.02 14.63 42.66 3.85
100 101 2.125912 CCGCCTCAAGACACCTCG 60.126 66.667 0.00 0.00 0.00 4.63
280 281 4.778213 TTTGGTATCCTCCAGATGGAAG 57.222 45.455 2.65 0.00 44.91 3.46
443 444 4.090588 TTCTTAGGCCACGCGGGG 62.091 66.667 26.87 26.87 37.04 5.73
449 450 2.173569 ACATGATCCCTTCTTAGGCCAC 59.826 50.000 5.01 0.00 40.50 5.01
910 913 3.003173 ACAGCTAGCTTCCCGCCA 61.003 61.111 16.46 0.00 40.39 5.69
992 995 1.942776 TGAGGAAGACATGGAGCTCA 58.057 50.000 17.19 1.87 0.00 4.26
1813 1960 2.475339 ATGGGCCTTATTGGATGCAA 57.525 45.000 4.53 0.79 38.35 4.08


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.