Multiple sequence alignment - TraesCS6B01G379000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G379000 chr6B 100.000 3101 0 0 1 3101 653789676 653786576 0.000000e+00 5727
1 TraesCS6B01G379000 chr6B 98.108 3118 42 2 1 3101 653716546 653713429 0.000000e+00 5415
2 TraesCS6B01G379000 chr6B 95.039 2177 85 13 1 2156 653195723 653193549 0.000000e+00 3400
3 TraesCS6B01G379000 chr6B 88.438 2638 219 33 1 2589 653857424 653854824 0.000000e+00 3103
4 TraesCS6B01G379000 chr6B 85.661 1869 197 35 705 2538 653699256 653697424 0.000000e+00 1901
5 TraesCS6B01G379000 chr6B 77.778 369 41 18 2599 2935 653854628 653854269 4.080000e-44 189
6 TraesCS6B01G379000 chr6B 76.567 367 42 19 2599 2933 653186863 653186509 8.900000e-36 161
7 TraesCS6B01G379000 chr6D 92.660 2793 144 27 3 2756 433260025 433257255 0.000000e+00 3965
8 TraesCS6B01G379000 chr6D 89.472 2574 198 22 37 2567 432915301 432912758 0.000000e+00 3184
9 TraesCS6B01G379000 chr6D 87.540 1878 186 19 704 2538 432931728 432929856 0.000000e+00 2128
10 TraesCS6B01G379000 chr6D 88.704 1682 163 12 705 2362 433280874 433279196 0.000000e+00 2028
11 TraesCS6B01G379000 chr6D 83.364 1641 225 32 833 2440 433533929 433535554 0.000000e+00 1474
12 TraesCS6B01G379000 chr6D 86.521 549 54 12 2059 2589 433037324 433036778 1.240000e-163 586
13 TraesCS6B01G379000 chr6D 89.882 425 21 14 2686 3101 432911715 432911304 7.620000e-146 527
14 TraesCS6B01G379000 chr6D 82.493 337 37 16 2610 2935 432928434 432928109 3.050000e-70 276
15 TraesCS6B01G379000 chr6A 88.860 2666 227 32 1 2636 579125811 579123186 0.000000e+00 3214
16 TraesCS6B01G379000 chr6A 83.356 1484 214 24 833 2305 579511324 579512785 0.000000e+00 1341


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G379000 chr6B 653786576 653789676 3100 True 5727.0 5727 100.0000 1 3101 1 chr6B.!!$R5 3100
1 TraesCS6B01G379000 chr6B 653713429 653716546 3117 True 5415.0 5415 98.1080 1 3101 1 chr6B.!!$R4 3100
2 TraesCS6B01G379000 chr6B 653193549 653195723 2174 True 3400.0 3400 95.0390 1 2156 1 chr6B.!!$R2 2155
3 TraesCS6B01G379000 chr6B 653697424 653699256 1832 True 1901.0 1901 85.6610 705 2538 1 chr6B.!!$R3 1833
4 TraesCS6B01G379000 chr6B 653854269 653857424 3155 True 1646.0 3103 83.1080 1 2935 2 chr6B.!!$R6 2934
5 TraesCS6B01G379000 chr6D 433257255 433260025 2770 True 3965.0 3965 92.6600 3 2756 1 chr6D.!!$R2 2753
6 TraesCS6B01G379000 chr6D 433279196 433280874 1678 True 2028.0 2028 88.7040 705 2362 1 chr6D.!!$R3 1657
7 TraesCS6B01G379000 chr6D 432911304 432915301 3997 True 1855.5 3184 89.6770 37 3101 2 chr6D.!!$R4 3064
8 TraesCS6B01G379000 chr6D 433533929 433535554 1625 False 1474.0 1474 83.3640 833 2440 1 chr6D.!!$F1 1607
9 TraesCS6B01G379000 chr6D 432928109 432931728 3619 True 1202.0 2128 85.0165 704 2935 2 chr6D.!!$R5 2231
10 TraesCS6B01G379000 chr6D 433036778 433037324 546 True 586.0 586 86.5210 2059 2589 1 chr6D.!!$R1 530
11 TraesCS6B01G379000 chr6A 579123186 579125811 2625 True 3214.0 3214 88.8600 1 2636 1 chr6A.!!$R1 2635
12 TraesCS6B01G379000 chr6A 579511324 579512785 1461 False 1341.0 1341 83.3560 833 2305 1 chr6A.!!$F1 1472

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
116 118 0.179059 TGTGTCGCTTGGTGATGTGT 60.179 50.000 0.0 0.0 0.0 3.72 F
873 893 1.153901 GTGCTTCACCGCTACGCTA 60.154 57.895 0.0 0.0 0.0 4.26 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1916 1961 2.498167 CTGCAATACCATGGTCTAGGC 58.502 52.381 23.76 20.45 0.00 3.93 R
2730 5389 0.621082 TGGAACACTGGTTGTCCACA 59.379 50.000 0.00 0.00 37.51 4.17 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
56 57 5.276868 CGAATGATTTTCGTAGCCCTACAAG 60.277 44.000 6.30 0.00 37.18 3.16
116 118 0.179059 TGTGTCGCTTGGTGATGTGT 60.179 50.000 0.00 0.00 0.00 3.72
338 341 9.816354 GGTGGTATTAAAATTATTGCACTTGAT 57.184 29.630 0.00 0.00 0.00 2.57
371 378 3.677121 GCTCATGCAGTCCATATAGAACG 59.323 47.826 0.00 0.00 39.41 3.95
873 893 1.153901 GTGCTTCACCGCTACGCTA 60.154 57.895 0.00 0.00 0.00 4.26
1868 1913 5.841209 AGCTGTAGATGGAGGAGATATGAT 58.159 41.667 0.00 0.00 0.00 2.45
1916 1961 2.034532 TGGCTCATGTGGCACTGG 59.965 61.111 18.85 10.81 37.59 4.00
2136 2182 2.932622 GCCACATATCCTCCTATGCACG 60.933 54.545 0.00 0.00 33.26 5.34
2465 2568 8.058667 AGTTGAAGCATGATGAATGTCAATTA 57.941 30.769 0.00 0.00 35.15 1.40
2730 5389 0.537143 TGTGCTGCGAGGTTCCAAAT 60.537 50.000 0.00 0.00 0.00 2.32
3071 5753 3.057596 CCTTTGCATATTGTGTCGGTGTT 60.058 43.478 0.00 0.00 0.00 3.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
56 57 1.064389 CATTTCTCCCCCTCCCTTGAC 60.064 57.143 0.00 0.00 0.00 3.18
116 118 4.207955 CCCTGCAGAGTAGACACACTATA 58.792 47.826 17.39 0.00 33.39 1.31
371 378 2.231964 TGGCACTCATCTTGCATTTTCC 59.768 45.455 0.00 0.00 42.12 3.13
873 893 5.555542 AGTATAGGAGATGGAGATGGTCTCT 59.444 44.000 6.89 0.00 42.95 3.10
1079 1108 3.686241 CACCATCGACAAGTCATCATTGT 59.314 43.478 0.72 0.00 43.38 2.71
1868 1913 4.601084 TCCACCTTTGTAAAACTGGAACA 58.399 39.130 0.00 0.00 0.00 3.18
1916 1961 2.498167 CTGCAATACCATGGTCTAGGC 58.502 52.381 23.76 20.45 0.00 3.93
2136 2182 5.527951 TGTGGGCAATTATTTGATATTCGC 58.472 37.500 1.55 0.00 34.60 4.70
2730 5389 0.621082 TGGAACACTGGTTGTCCACA 59.379 50.000 0.00 0.00 37.51 4.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.