Multiple sequence alignment - TraesCS6B01G348600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G348600 chr6B 100.000 2369 0 0 1 2369 613188823 613186455 0 4375
1 TraesCS6B01G348600 chr6B 98.354 2369 35 2 1 2369 613159989 613157625 0 4156
2 TraesCS6B01G348600 chr6B 96.751 2370 74 3 1 2369 306993348 306990981 0 3947
3 TraesCS6B01G348600 chr7D 97.343 2371 59 3 1 2369 203518118 203520486 0 4026
4 TraesCS6B01G348600 chr7B 97.175 2372 62 4 1 2369 644470083 644472452 0 4004
5 TraesCS6B01G348600 chr7A 97.091 2372 64 4 1 2369 60120926 60118557 0 3993
6 TraesCS6B01G348600 chr7A 96.543 2372 76 5 1 2369 63429291 63431659 0 3921
7 TraesCS6B01G348600 chr3A 96.795 2371 71 4 1 2369 633113890 633116257 0 3952


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G348600 chr6B 613186455 613188823 2368 True 4375 4375 100.000 1 2369 1 chr6B.!!$R3 2368
1 TraesCS6B01G348600 chr6B 613157625 613159989 2364 True 4156 4156 98.354 1 2369 1 chr6B.!!$R2 2368
2 TraesCS6B01G348600 chr6B 306990981 306993348 2367 True 3947 3947 96.751 1 2369 1 chr6B.!!$R1 2368
3 TraesCS6B01G348600 chr7D 203518118 203520486 2368 False 4026 4026 97.343 1 2369 1 chr7D.!!$F1 2368
4 TraesCS6B01G348600 chr7B 644470083 644472452 2369 False 4004 4004 97.175 1 2369 1 chr7B.!!$F1 2368
5 TraesCS6B01G348600 chr7A 60118557 60120926 2369 True 3993 3993 97.091 1 2369 1 chr7A.!!$R1 2368
6 TraesCS6B01G348600 chr7A 63429291 63431659 2368 False 3921 3921 96.543 1 2369 1 chr7A.!!$F1 2368
7 TraesCS6B01G348600 chr3A 633113890 633116257 2367 False 3952 3952 96.795 1 2369 1 chr3A.!!$F1 2368

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
737 738 2.106857 CCCTAGAGGAGTCGTATGAGGT 59.893 54.545 0.0 0.0 38.24 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1861 1863 0.261402 CATTGCCCCCAGTATTCCCA 59.739 55.0 0.0 0.0 0.0 4.37 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
241 242 6.097412 CCTAGATCTTCCCATTTCCAAAAAGG 59.903 42.308 0.00 0.00 39.47 3.11
737 738 2.106857 CCCTAGAGGAGTCGTATGAGGT 59.893 54.545 0.00 0.00 38.24 3.85
1104 1105 3.869912 GCATGTACATTGTCACACTCCCT 60.870 47.826 5.37 0.00 0.00 4.20
1422 1424 1.915489 ACCAATGATCTGTGCCTACCA 59.085 47.619 0.00 0.00 0.00 3.25
1724 1726 2.093235 TGAAAGGGGTTGCCAACAAAAG 60.093 45.455 10.18 0.00 37.58 2.27
1861 1863 2.228822 CGCCCTTTTCAAAGCTACATGT 59.771 45.455 2.69 2.69 34.69 3.21
1907 1909 8.791298 AGCCCTTCTTCTCTTATTCTATACTT 57.209 34.615 0.00 0.00 0.00 2.24
1908 1910 9.219715 AGCCCTTCTTCTCTTATTCTATACTTT 57.780 33.333 0.00 0.00 0.00 2.66
2146 2150 9.851267 AATCTATAGTCTAGATTCCATTCCCTT 57.149 33.333 5.23 0.00 39.34 3.95
2321 2325 3.188667 GGGCTTGACTTTCCTTACTTTCG 59.811 47.826 0.00 0.00 0.00 3.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
241 242 5.070685 ACTAAACCAGATCAAACAAGGGAC 58.929 41.667 0.00 0.00 0.00 4.46
453 454 1.395826 CGGAGTAGCCCCCTTCAGAG 61.396 65.000 0.00 0.00 0.00 3.35
496 497 3.368323 GCAATGAATCCCCAACGACAAAT 60.368 43.478 0.00 0.00 0.00 2.32
737 738 1.045407 AACTGTACGTGGAGCTTCCA 58.955 50.000 0.00 1.25 45.98 3.53
1367 1369 1.981256 AGGTTGTGCCGAGTCAAATT 58.019 45.000 0.00 0.00 43.70 1.82
1724 1726 1.343580 ACTAGGGCCTCTTTCCTCTCC 60.344 57.143 10.74 0.00 34.75 3.71
1861 1863 0.261402 CATTGCCCCCAGTATTCCCA 59.739 55.000 0.00 0.00 0.00 4.37
2321 2325 4.648651 TCTTTTTACAGTAGAGGGGTTGC 58.351 43.478 0.00 0.00 0.00 4.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.