Multiple sequence alignment - TraesCS6B01G341000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G341000 chr6B 100.000 2264 0 0 1 2264 599876101 599878364 0.000000e+00 4181.0
1 TraesCS6B01G341000 chr6B 96.434 1935 69 0 204 2138 181111360 181109426 0.000000e+00 3192.0
2 TraesCS6B01G341000 chr6B 99.043 209 2 0 1 209 26498704 26498496 2.120000e-100 375.0
3 TraesCS6B01G341000 chr6B 98.565 209 3 0 1 209 679250567 679250775 9.880000e-99 370.0
4 TraesCS6B01G341000 chr6B 98.901 91 1 0 2174 2264 84606559 84606649 1.800000e-36 163.0
5 TraesCS6B01G341000 chr6B 98.901 91 1 0 2174 2264 181108396 181108306 1.800000e-36 163.0
6 TraesCS6B01G341000 chr6B 98.901 91 1 0 2174 2264 679254815 679254905 1.800000e-36 163.0
7 TraesCS6B01G341000 chr6B 100.000 33 0 0 2144 2176 599878011 599878043 6.750000e-06 62.1
8 TraesCS6B01G341000 chr2B 97.521 1977 48 1 201 2176 549353046 549355022 0.000000e+00 3378.0
9 TraesCS6B01G341000 chr2B 96.719 1859 56 5 201 2056 454449425 454451281 0.000000e+00 3090.0
10 TraesCS6B01G341000 chr2B 96.665 1859 57 5 201 2056 454473558 454475414 0.000000e+00 3085.0
11 TraesCS6B01G341000 chr2B 99.034 207 2 0 3 209 454472297 454472503 2.750000e-99 372.0
12 TraesCS6B01G341000 chr2B 98.565 209 3 0 1 209 454448161 454448369 9.880000e-99 370.0
13 TraesCS6B01G341000 chr2B 98.565 209 3 0 1 209 549352152 549352360 9.880000e-99 370.0
14 TraesCS6B01G341000 chr3B 96.815 1978 58 2 204 2176 604265839 604263862 0.000000e+00 3299.0
15 TraesCS6B01G341000 chr3B 99.043 209 2 0 1 209 760824663 760824871 2.120000e-100 375.0
16 TraesCS6B01G341000 chr5B 96.441 1939 66 2 201 2138 506965744 506967680 0.000000e+00 3195.0
17 TraesCS6B01G341000 chr5B 99.043 209 2 0 1 209 584817959 584817751 2.120000e-100 375.0
18 TraesCS6B01G341000 chr5B 98.565 209 3 0 1 209 506964479 506964687 9.880000e-99 370.0
19 TraesCS6B01G341000 chr5B 98.901 91 1 0 2174 2264 234882384 234882294 1.800000e-36 163.0
20 TraesCS6B01G341000 chr5B 98.901 91 1 0 2174 2264 506968773 506968863 1.800000e-36 163.0
21 TraesCS6B01G341000 chr5B 98.901 91 1 0 2174 2264 584813475 584813385 1.800000e-36 163.0
22 TraesCS6B01G341000 chr5B 98.901 91 1 0 2174 2264 709183549 709183459 1.800000e-36 163.0
23 TraesCS6B01G341000 chr4B 96.390 1939 63 5 201 2138 551060237 551062169 0.000000e+00 3186.0
24 TraesCS6B01G341000 chr4B 98.565 209 3 0 1 209 396489412 396489620 9.880000e-99 370.0
25 TraesCS6B01G341000 chr4B 98.901 91 1 0 2174 2264 588827107 588827197 1.800000e-36 163.0
26 TraesCS6B01G341000 chr1B 97.133 1814 52 0 204 2017 571422200 571420387 0.000000e+00 3062.0
27 TraesCS6B01G341000 chr1B 98.901 91 1 0 2174 2264 571419241 571419151 1.800000e-36 163.0
28 TraesCS6B01G341000 chr4D 92.626 1980 126 20 204 2172 470196434 470194464 0.000000e+00 2830.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G341000 chr6B 599876101 599878364 2263 False 2121.550000 4181 100.0000 1 2264 2 chr6B.!!$F4 2263
1 TraesCS6B01G341000 chr6B 181108306 181111360 3054 True 1677.500000 3192 97.6675 204 2264 2 chr6B.!!$R2 2060
2 TraesCS6B01G341000 chr2B 549352152 549355022 2870 False 1874.000000 3378 98.0430 1 2176 2 chr2B.!!$F3 2175
3 TraesCS6B01G341000 chr2B 454448161 454451281 3120 False 1730.000000 3090 97.6420 1 2056 2 chr2B.!!$F1 2055
4 TraesCS6B01G341000 chr2B 454472297 454475414 3117 False 1728.500000 3085 97.8495 3 2056 2 chr2B.!!$F2 2053
5 TraesCS6B01G341000 chr3B 604263862 604265839 1977 True 3299.000000 3299 96.8150 204 2176 1 chr3B.!!$R1 1972
6 TraesCS6B01G341000 chr5B 506964479 506968863 4384 False 1242.666667 3195 97.9690 1 2264 3 chr5B.!!$F1 2263
7 TraesCS6B01G341000 chr4B 551060237 551062169 1932 False 3186.000000 3186 96.3900 201 2138 1 chr4B.!!$F2 1937
8 TraesCS6B01G341000 chr1B 571419151 571422200 3049 True 1612.500000 3062 98.0170 204 2264 2 chr1B.!!$R1 2060
9 TraesCS6B01G341000 chr4D 470194464 470196434 1970 True 2830.000000 2830 92.6260 204 2172 1 chr4D.!!$R1 1968

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
481 1549 0.109342 CATGGTGCCTATGAGGGGAC 59.891 60.0 0.0 0.0 45.19 4.46 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1976 3047 1.586154 CGTCACAGAACCATTGCCCC 61.586 60.0 0.0 0.0 0.0 5.8 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
69 70 3.592898 AATCAAAGAAACCGGGCAATC 57.407 42.857 6.32 0.00 0.00 2.67
202 1270 5.526115 CATCAAATAGCACATGATCCAACC 58.474 41.667 0.00 0.00 31.65 3.77
206 1274 0.324614 AGCACATGATCCAACCGTGA 59.675 50.000 0.00 0.00 0.00 4.35
436 1504 0.618458 GTGGCCTGAGTATGTTGGGA 59.382 55.000 3.32 0.00 0.00 4.37
481 1549 0.109342 CATGGTGCCTATGAGGGGAC 59.891 60.000 0.00 0.00 45.19 4.46
488 1556 1.485066 GCCTATGAGGGGACGAAGAAA 59.515 52.381 0.00 0.00 35.37 2.52
633 1701 2.946329 ACACAACGTTAGGACATGCAAA 59.054 40.909 0.00 0.00 0.00 3.68
926 1995 9.931210 GGTACTACTTTTAATATGTTCATGCAC 57.069 33.333 0.00 0.00 0.00 4.57
1308 2377 2.039613 TGTGTGCCATCACTAACATCCA 59.960 45.455 5.62 0.00 43.49 3.41
1510 2579 2.841988 GCGAGGAGGAGAGGGCAT 60.842 66.667 0.00 0.00 0.00 4.40
1547 2616 1.544825 CGTGAGGAGGAGAGGGCAAA 61.545 60.000 0.00 0.00 0.00 3.68
1743 2812 3.049912 TCGTCAACTTGTCGTGAATGAG 58.950 45.455 8.03 0.00 31.27 2.90
1947 3018 1.847798 ATGGCGGTAGGTTGCTGGAA 61.848 55.000 0.00 0.00 0.00 3.53
1960 3031 1.987855 CTGGAACCTACCGCCAGGA 60.988 63.158 7.47 0.00 44.24 3.86
1976 3047 2.281761 GATGCATGGCGGTAGGGG 60.282 66.667 2.46 0.00 0.00 4.79
2008 3079 2.432874 TCTGTGACGAAGAACCCAAGAA 59.567 45.455 0.00 0.00 0.00 2.52
2055 3126 2.120909 CAAAGGCCATGGCGGTAGG 61.121 63.158 29.90 14.39 43.06 3.18
2077 3148 3.976490 CTGGACCCTACCGCCAGGA 62.976 68.421 0.00 0.00 44.24 3.86
2078 3149 3.468140 GGACCCTACCGCCAGGAC 61.468 72.222 0.00 0.00 41.02 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
22 23 1.434696 GCGGACCATCCATTTGCAG 59.565 57.895 0.00 0.00 35.91 4.41
69 70 2.738846 CCAACATGACTCTTCAAGACCG 59.261 50.000 0.00 0.00 34.61 4.79
202 1270 1.455786 CACCTCGTAAGCAACTTCACG 59.544 52.381 0.00 0.00 35.78 4.35
206 1274 1.566018 GCGCACCTCGTAAGCAACTT 61.566 55.000 0.30 0.00 41.07 2.66
436 1504 1.340405 GGGATCTGGCACAATGTCTGT 60.340 52.381 0.00 0.00 38.70 3.41
488 1556 4.040461 TGTCACTCCGGAATCTCTTCTTTT 59.960 41.667 5.23 0.00 0.00 2.27
633 1701 2.608268 CCCGTGTTGGTTTTTCGTTTT 58.392 42.857 0.00 0.00 35.15 2.43
641 1709 0.181824 ACTAGTGCCCGTGTTGGTTT 59.818 50.000 0.00 0.00 35.15 3.27
926 1995 7.915508 TGTAAAGAGGCAAATATATCAACACG 58.084 34.615 0.00 0.00 0.00 4.49
1308 2377 3.815401 GAGGCGGTGACTGCATATAAAAT 59.185 43.478 19.20 0.00 0.00 1.82
1396 2465 3.649073 GTTGGCGCCTAAAACAATCTTT 58.351 40.909 29.70 0.00 0.00 2.52
1743 2812 7.076983 CACCAAATTCAATACAAATGGCAAAC 58.923 34.615 0.00 0.00 0.00 2.93
1947 3018 2.072487 ATGCATCCTGGCGGTAGGT 61.072 57.895 0.00 0.00 38.99 3.08
1960 3031 3.889692 CCCCCTACCGCCATGCAT 61.890 66.667 0.00 0.00 0.00 3.96
1976 3047 1.586154 CGTCACAGAACCATTGCCCC 61.586 60.000 0.00 0.00 0.00 5.80
1986 3057 2.432874 TCTTGGGTTCTTCGTCACAGAA 59.567 45.455 0.00 0.00 0.00 3.02
2039 3110 2.612493 AACCTACCGCCATGGCCTT 61.612 57.895 30.79 19.65 43.94 4.35
2055 3126 2.436115 GCGGTAGGGTCCAGCAAC 60.436 66.667 0.00 0.00 0.00 4.17
2155 3451 2.612493 AACCTACCGCCATGGCCTT 61.612 57.895 30.79 19.65 43.94 4.35
2204 4530 5.705441 GTCAGGTCATTGATTGGTTAGTTCA 59.295 40.000 0.00 0.00 0.00 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.