Multiple sequence alignment - TraesCS6B01G340600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G340600 chr6B 100.000 2509 0 0 1 2509 599733776 599736284 0.000000e+00 4634.0
1 TraesCS6B01G340600 chr7B 92.427 1994 110 19 525 2507 746433841 746431878 0.000000e+00 2808.0
2 TraesCS6B01G340600 chr7B 92.350 1085 54 13 1189 2261 742230891 742231958 0.000000e+00 1517.0
3 TraesCS6B01G340600 chr7B 96.809 94 3 0 2341 2434 742231955 742232048 9.290000e-35 158.0
4 TraesCS6B01G340600 chr6A 94.077 1452 75 4 1036 2476 587694992 587696443 0.000000e+00 2194.0
5 TraesCS6B01G340600 chr6A 93.567 513 27 3 525 1032 587694420 587694931 0.000000e+00 760.0
6 TraesCS6B01G340600 chr2A 93.591 1451 61 8 1036 2476 715601448 715602876 0.000000e+00 2135.0
7 TraesCS6B01G340600 chr2A 92.070 1488 74 6 1036 2507 757610962 757612421 0.000000e+00 2054.0
8 TraesCS6B01G340600 chr2A 91.250 1520 83 25 1036 2507 31001967 31000450 0.000000e+00 2025.0
9 TraesCS6B01G340600 chr2A 94.367 1296 61 3 1192 2476 105515002 105516296 0.000000e+00 1978.0
10 TraesCS6B01G340600 chr2A 90.409 782 38 13 264 1032 757610144 757610901 0.000000e+00 994.0
11 TraesCS6B01G340600 chr2A 93.823 599 35 2 1879 2476 935951 936548 0.000000e+00 900.0
12 TraesCS6B01G340600 chr2A 92.821 599 41 2 1879 2476 874072 874669 0.000000e+00 867.0
13 TraesCS6B01G340600 chr2A 94.685 508 23 3 525 1032 31002531 31002028 0.000000e+00 785.0
14 TraesCS6B01G340600 chr2A 93.969 514 24 2 525 1032 715600869 715601381 0.000000e+00 771.0
15 TraesCS6B01G340600 chr2A 94.321 405 16 4 521 919 105514416 105514819 4.590000e-172 614.0
16 TraesCS6B01G340600 chr2A 95.055 182 8 1 1 181 757609953 757610134 4.080000e-73 285.0
17 TraesCS6B01G340600 chr3A 92.174 1495 85 10 1036 2507 750649711 750648226 0.000000e+00 2084.0
18 TraesCS6B01G340600 chr3A 89.988 819 41 16 1 787 706416805 706417614 0.000000e+00 1020.0
19 TraesCS6B01G340600 chr3A 95.669 508 18 3 525 1032 750650279 750649776 0.000000e+00 813.0
20 TraesCS6B01G340600 chr3A 88.889 90 10 0 2330 2419 706418574 706418663 7.340000e-21 111.0
21 TraesCS6B01G340600 chrUn 98.471 1112 17 0 1396 2507 8795134 8794023 0.000000e+00 1960.0
22 TraesCS6B01G340600 chrUn 97.603 751 9 1 1 742 8800637 8799887 0.000000e+00 1279.0
23 TraesCS6B01G340600 chrUn 94.500 400 16 3 525 919 323726128 323725730 1.650000e-171 612.0
24 TraesCS6B01G340600 chrUn 97.993 299 6 0 1078 1376 8797802 8797504 1.030000e-143 520.0
25 TraesCS6B01G340600 chrUn 97.682 302 7 0 739 1040 8798102 8797801 1.030000e-143 520.0
26 TraesCS6B01G340600 chrUn 98.630 73 1 0 960 1032 323725735 323725663 2.030000e-26 130.0
27 TraesCS6B01G340600 chrUn 100.000 69 0 0 964 1032 328416711 328416643 7.280000e-26 128.0
28 TraesCS6B01G340600 chrUn 90.625 96 8 1 2325 2419 216361303 216361398 2.620000e-25 126.0
29 TraesCS6B01G340600 chrUn 90.625 96 8 1 2325 2419 216373005 216373100 2.620000e-25 126.0
30 TraesCS6B01G340600 chrUn 96.429 56 2 0 1036 1091 323725600 323725545 2.660000e-15 93.5
31 TraesCS6B01G340600 chrUn 96.429 56 2 0 1036 1091 328416580 328416525 2.660000e-15 93.5
32 TraesCS6B01G340600 chr2D 89.235 353 31 5 1040 1390 382372666 382372319 3.830000e-118 435.0
33 TraesCS6B01G340600 chr3B 90.580 138 10 2 2325 2462 776974026 776973892 1.980000e-41 180.0
34 TraesCS6B01G340600 chr5A 90.789 76 7 0 2344 2419 464671663 464671738 4.420000e-18 102.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G340600 chr6B 599733776 599736284 2508 False 4634.00 4634 100.000000 1 2509 1 chr6B.!!$F1 2508
1 TraesCS6B01G340600 chr7B 746431878 746433841 1963 True 2808.00 2808 92.427000 525 2507 1 chr7B.!!$R1 1982
2 TraesCS6B01G340600 chr7B 742230891 742232048 1157 False 837.50 1517 94.579500 1189 2434 2 chr7B.!!$F1 1245
3 TraesCS6B01G340600 chr6A 587694420 587696443 2023 False 1477.00 2194 93.822000 525 2476 2 chr6A.!!$F1 1951
4 TraesCS6B01G340600 chr2A 715600869 715602876 2007 False 1453.00 2135 93.780000 525 2476 2 chr2A.!!$F4 1951
5 TraesCS6B01G340600 chr2A 31000450 31002531 2081 True 1405.00 2025 92.967500 525 2507 2 chr2A.!!$R1 1982
6 TraesCS6B01G340600 chr2A 105514416 105516296 1880 False 1296.00 1978 94.344000 521 2476 2 chr2A.!!$F3 1955
7 TraesCS6B01G340600 chr2A 757609953 757612421 2468 False 1111.00 2054 92.511333 1 2507 3 chr2A.!!$F5 2506
8 TraesCS6B01G340600 chr2A 935951 936548 597 False 900.00 900 93.823000 1879 2476 1 chr2A.!!$F2 597
9 TraesCS6B01G340600 chr2A 874072 874669 597 False 867.00 867 92.821000 1879 2476 1 chr2A.!!$F1 597
10 TraesCS6B01G340600 chr3A 750648226 750650279 2053 True 1448.50 2084 93.921500 525 2507 2 chr3A.!!$R1 1982
11 TraesCS6B01G340600 chr3A 706416805 706418663 1858 False 565.50 1020 89.438500 1 2419 2 chr3A.!!$F1 2418
12 TraesCS6B01G340600 chrUn 8794023 8800637 6614 True 1069.75 1960 97.937250 1 2507 4 chrUn.!!$R1 2506
13 TraesCS6B01G340600 chrUn 323725545 323726128 583 True 278.50 612 96.519667 525 1091 3 chrUn.!!$R2 566

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
298 317 2.046892 CACCCAAGGGAGACGCAG 60.047 66.667 13.15 0.0 38.96 5.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2225 6588 0.250684 ATGAACGGTGTGTGATGGCA 60.251 50.0 0.0 0.0 0.0 4.92 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
298 317 2.046892 CACCCAAGGGAGACGCAG 60.047 66.667 13.15 0.0 38.96 5.18
1157 3110 5.422650 GGAGTACCATCTCTCAGGTTAACTT 59.577 44.000 5.42 0.0 39.31 2.66
1161 3114 6.287589 ACCATCTCTCAGGTTAACTTACAG 57.712 41.667 5.42 0.0 33.39 2.74
1347 3300 3.562826 GGTGGCATACATCCATCCATCAT 60.563 47.826 0.00 0.0 35.81 2.45
1619 5936 1.451028 GCAGAGAAGAATGCGCCCT 60.451 57.895 4.18 0.0 31.87 5.19
1746 6065 1.372128 GCGTCCACTTCGTTACCGT 60.372 57.895 0.00 0.0 35.01 4.83
2315 6905 1.822613 CGCAGCCCGTCCTCTACTA 60.823 63.158 0.00 0.0 0.00 1.82
2324 6914 1.267433 CGTCCTCTACTAAGTCGCACG 60.267 57.143 0.00 0.0 0.00 5.34
2411 7125 2.173356 GGAGATCCATCCATTCACCACA 59.827 50.000 0.00 0.0 39.34 4.17
2455 7169 1.809619 CGCCACATCCATTCGTCGT 60.810 57.895 0.00 0.0 0.00 4.34
2476 7190 1.166531 GGCGCTACATCCATCCAACC 61.167 60.000 7.64 0.0 0.00 3.77
2507 7228 0.251033 CATCACGCCCATCCATCCAT 60.251 55.000 0.00 0.0 0.00 3.41
2508 7229 0.037303 ATCACGCCCATCCATCCATC 59.963 55.000 0.00 0.0 0.00 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
53 54 2.087009 CGCCGTCGTCTCCTTTGAC 61.087 63.158 0.00 0.00 0.00 3.18
859 2739 1.485838 GCTCATCTGCATGTCGACGG 61.486 60.000 11.62 6.88 0.00 4.79
1054 3007 1.903877 CTGCCCGTCCTCCTTGTCAT 61.904 60.000 0.00 0.00 0.00 3.06
1619 5936 4.680237 CCTCGTCGCTGCCACCAA 62.680 66.667 0.00 0.00 0.00 3.67
1746 6065 2.110835 TTGTCTTCTGCAGCGCCA 59.889 55.556 9.47 0.00 0.00 5.69
2225 6588 0.250684 ATGAACGGTGTGTGATGGCA 60.251 50.000 0.00 0.00 0.00 4.92
2315 6905 3.303135 TGCCCTCTCGTGCGACTT 61.303 61.111 0.00 0.00 0.00 3.01
2324 6914 4.664677 ACGCGTGTGTGCCCTCTC 62.665 66.667 12.93 0.00 0.00 3.20
2411 7125 2.743126 CGAGTCTTCTCTTAGGACGTGT 59.257 50.000 0.00 0.00 38.45 4.49
2455 7169 1.681486 TTGGATGGATGTAGCGCCGA 61.681 55.000 2.29 0.00 0.00 5.54
2476 7190 2.753043 GTGATGGCTGGCTGGTGG 60.753 66.667 2.00 0.00 0.00 4.61


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.