Multiple sequence alignment - TraesCS6B01G338800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G338800 chr6B 100.000 2285 0 0 1 2285 596657305 596655021 0 4220
1 TraesCS6B01G338800 chr1A 98.995 2289 19 2 1 2285 238109744 238107456 0 4096
2 TraesCS6B01G338800 chr1A 98.908 2289 21 2 1 2285 238155129 238152841 0 4085
3 TraesCS6B01G338800 chr5A 98.908 2289 21 2 1 2285 16577919 16575631 0 4085
4 TraesCS6B01G338800 chr7D 98.906 2286 24 1 1 2285 579015579 579017864 0 4082
5 TraesCS6B01G338800 chrUn 98.819 2286 23 2 1 2285 237257829 237255547 0 4069
6 TraesCS6B01G338800 chr7A 98.646 2289 27 2 1 2285 60329009 60326721 0 4052


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G338800 chr6B 596655021 596657305 2284 True 4220 4220 100.000 1 2285 1 chr6B.!!$R1 2284
1 TraesCS6B01G338800 chr1A 238107456 238109744 2288 True 4096 4096 98.995 1 2285 1 chr1A.!!$R1 2284
2 TraesCS6B01G338800 chr1A 238152841 238155129 2288 True 4085 4085 98.908 1 2285 1 chr1A.!!$R2 2284
3 TraesCS6B01G338800 chr5A 16575631 16577919 2288 True 4085 4085 98.908 1 2285 1 chr5A.!!$R1 2284
4 TraesCS6B01G338800 chr7D 579015579 579017864 2285 False 4082 4082 98.906 1 2285 1 chr7D.!!$F1 2284
5 TraesCS6B01G338800 chrUn 237255547 237257829 2282 True 4069 4069 98.819 1 2285 1 chrUn.!!$R1 2284
6 TraesCS6B01G338800 chr7A 60326721 60329009 2288 True 4052 4052 98.646 1 2285 1 chr7A.!!$R1 2284

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
881 882 1.132527 TCAGTGGGAAGAGAAAGGGGA 60.133 52.381 0.0 0.0 0.0 4.81 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1963 1969 1.682854 CTTTTTGTGGCTTCCTGCTCA 59.317 47.619 0.0 0.0 42.39 4.26 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
251 252 1.154225 CAACGAGTGGCGGATTTGC 60.154 57.895 0.00 0.00 46.49 3.68
552 553 1.759445 CCTCAGATTGATGGAGTCCGT 59.241 52.381 2.64 2.64 0.00 4.69
874 875 4.771114 TTCTTGTTTCAGTGGGAAGAGA 57.229 40.909 0.00 0.00 36.72 3.10
881 882 1.132527 TCAGTGGGAAGAGAAAGGGGA 60.133 52.381 0.00 0.00 0.00 4.81
888 889 2.291865 GGAAGAGAAAGGGGAATTGCCT 60.292 50.000 16.31 0.00 36.66 4.75
1502 1505 1.065199 CCCAGAAGCAAGGAGTATGCA 60.065 52.381 0.00 0.00 46.22 3.96
1904 1910 6.072008 TCGCAAATTTCATTGAGAGGAATCAA 60.072 34.615 0.00 0.00 43.04 2.57
1963 1969 2.047465 CAGCGTGGCTTCTCTGCT 60.047 61.111 0.00 0.00 36.40 4.24
2181 2190 2.605030 GCGCTTTATGGCATTTCAACA 58.395 42.857 4.78 0.00 0.00 3.33
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
251 252 0.035056 AAGCGAGACCCCATCCAAAG 60.035 55.000 0.00 0.0 0.00 2.77
374 375 3.684908 TGTTGATCGGAATTGGATGTGT 58.315 40.909 0.00 0.0 0.00 3.72
552 553 0.100682 GCAGCTATTCTGTCCGACGA 59.899 55.000 0.00 0.0 44.66 4.20
874 875 2.414250 TTCCAAGGCAATTCCCCTTT 57.586 45.000 4.53 0.0 40.63 3.11
881 882 4.020839 CACTGAAGGATTTCCAAGGCAATT 60.021 41.667 0.00 0.0 38.89 2.32
888 889 3.146066 CGAACCACTGAAGGATTTCCAA 58.854 45.455 0.00 0.0 38.89 3.53
1502 1505 0.782384 GTTCTCGTCGAAACACGCAT 59.218 50.000 12.43 0.0 39.74 4.73
1904 1910 5.241728 CCCGGAGAAGATTTCTTTTCTTTGT 59.758 40.000 0.73 0.0 40.87 2.83
1963 1969 1.682854 CTTTTTGTGGCTTCCTGCTCA 59.317 47.619 0.00 0.0 42.39 4.26
2181 2190 4.415596 TGTGGGATTGGATTAGTTTGCTT 58.584 39.130 0.00 0.0 0.00 3.91
2238 2247 4.649267 TGACACTTGGAAATATGGTCCA 57.351 40.909 0.00 0.0 43.57 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.