Multiple sequence alignment - TraesCS6B01G338700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G338700 chr6B 100.000 2378 0 0 1 2378 596656905 596654528 0 4392
1 TraesCS6B01G338700 chr1A 98.992 2382 20 2 1 2378 238109344 238106963 0 4263
2 TraesCS6B01G338700 chr1A 98.992 2382 20 2 1 2378 238154729 238152348 0 4263
3 TraesCS6B01G338700 chr5A 98.908 2382 22 2 1 2378 16577519 16575138 0 4252
4 TraesCS6B01G338700 chr7A 98.783 2382 25 2 1 2378 60328609 60326228 0 4235
5 TraesCS6B01G338700 chrUn 98.445 2379 33 2 1 2378 237257429 237255054 0 4185
6 TraesCS6B01G338700 chr3B 98.405 2382 32 4 1 2378 483372717 483375096 0 4183
7 TraesCS6B01G338700 chr7D 98.403 2379 37 1 1 2378 579015979 579018357 0 4181
8 TraesCS6B01G338700 chr1B 98.195 2382 36 5 1 2378 672508149 672505771 0 4154
9 TraesCS6B01G338700 chr4D 97.856 2379 50 1 1 2378 123520435 123518057 0 4109


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G338700 chr6B 596654528 596656905 2377 True 4392 4392 100.000 1 2378 1 chr6B.!!$R1 2377
1 TraesCS6B01G338700 chr1A 238106963 238109344 2381 True 4263 4263 98.992 1 2378 1 chr1A.!!$R1 2377
2 TraesCS6B01G338700 chr1A 238152348 238154729 2381 True 4263 4263 98.992 1 2378 1 chr1A.!!$R2 2377
3 TraesCS6B01G338700 chr5A 16575138 16577519 2381 True 4252 4252 98.908 1 2378 1 chr5A.!!$R1 2377
4 TraesCS6B01G338700 chr7A 60326228 60328609 2381 True 4235 4235 98.783 1 2378 1 chr7A.!!$R1 2377
5 TraesCS6B01G338700 chrUn 237255054 237257429 2375 True 4185 4185 98.445 1 2378 1 chrUn.!!$R1 2377
6 TraesCS6B01G338700 chr3B 483372717 483375096 2379 False 4183 4183 98.405 1 2378 1 chr3B.!!$F1 2377
7 TraesCS6B01G338700 chr7D 579015979 579018357 2378 False 4181 4181 98.403 1 2378 1 chr7D.!!$F1 2377
8 TraesCS6B01G338700 chr1B 672505771 672508149 2378 True 4154 4154 98.195 1 2378 1 chr1B.!!$R1 2377
9 TraesCS6B01G338700 chr4D 123518057 123520435 2378 True 4109 4109 97.856 1 2378 1 chr4D.!!$R1 2377

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
481 482 1.132527 TCAGTGGGAAGAGAAAGGGGA 60.133 52.381 0.0 0.0 0.0 4.81 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1563 1566 1.682854 CTTTTTGTGGCTTCCTGCTCA 59.317 47.619 0.0 0.0 42.39 4.26 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
474 475 4.771114 TTCTTGTTTCAGTGGGAAGAGA 57.229 40.909 0.00 0.0 36.72 3.10
481 482 1.132527 TCAGTGGGAAGAGAAAGGGGA 60.133 52.381 0.00 0.0 0.00 4.81
488 489 2.291865 GGAAGAGAAAGGGGAATTGCCT 60.292 50.000 16.31 0.0 36.66 4.75
1102 1105 1.065199 CCCAGAAGCAAGGAGTATGCA 60.065 52.381 0.00 0.0 46.22 3.96
1563 1566 2.047465 CAGCGTGGCTTCTCTGCT 60.047 61.111 0.00 0.0 36.40 4.24
2021 2027 0.034477 CAATGCTCCTAACGGGGGTT 60.034 55.000 0.00 0.0 38.03 4.11
2227 2233 5.428457 TCATGTATTGTGGAATAGTGAGGGT 59.572 40.000 0.00 0.0 0.00 4.34
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
474 475 2.414250 TTCCAAGGCAATTCCCCTTT 57.586 45.000 4.53 0.0 40.63 3.11
481 482 4.020839 CACTGAAGGATTTCCAAGGCAATT 60.021 41.667 0.00 0.0 38.89 2.32
488 489 3.146066 CGAACCACTGAAGGATTTCCAA 58.854 45.455 0.00 0.0 38.89 3.53
1102 1105 0.782384 GTTCTCGTCGAAACACGCAT 59.218 50.000 12.43 0.0 39.74 4.73
1563 1566 1.682854 CTTTTTGTGGCTTCCTGCTCA 59.317 47.619 0.00 0.0 42.39 4.26
1838 1844 4.649267 TGACACTTGGAAATATGGTCCA 57.351 40.909 0.00 0.0 43.57 4.02
2021 2027 3.778629 GGAGGTTGGTCTATGGGAAAGTA 59.221 47.826 0.00 0.0 0.00 2.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.