Multiple sequence alignment - TraesCS6B01G338600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G338600 chr6B 100.000 2816 0 0 1 2816 596628844 596631659 0 5201
1 TraesCS6B01G338600 chrUn 99.397 2818 15 2 1 2816 222680160 222677343 0 5108
2 TraesCS6B01G338600 chrUn 99.397 2817 16 1 1 2816 86449117 86451933 0 5107
3 TraesCS6B01G338600 chrUn 99.361 2817 16 2 1 2816 86455117 86457932 0 5101
4 TraesCS6B01G338600 chr5B 99.361 2818 16 2 1 2816 533066664 533069481 0 5103
5 TraesCS6B01G338600 chr1A 99.326 2819 16 3 1 2816 238117485 238120303 0 5097
6 TraesCS6B01G338600 chr1A 99.290 2817 19 1 1 2816 238121408 238124224 0 5090
7 TraesCS6B01G338600 chr3B 98.865 2819 29 2 1 2816 92326382 92329200 0 5025
8 TraesCS6B01G338600 chr3A 98.509 2817 38 4 1 2816 694367026 694364213 0 4966
9 TraesCS6B01G338600 chr2A 97.090 2818 68 11 1 2816 444294984 444292179 0 4737


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G338600 chr6B 596628844 596631659 2815 False 5201.0 5201 100.000 1 2816 1 chr6B.!!$F1 2815
1 TraesCS6B01G338600 chrUn 222677343 222680160 2817 True 5108.0 5108 99.397 1 2816 1 chrUn.!!$R1 2815
2 TraesCS6B01G338600 chrUn 86449117 86457932 8815 False 5104.0 5107 99.379 1 2816 2 chrUn.!!$F1 2815
3 TraesCS6B01G338600 chr5B 533066664 533069481 2817 False 5103.0 5103 99.361 1 2816 1 chr5B.!!$F1 2815
4 TraesCS6B01G338600 chr1A 238117485 238124224 6739 False 5093.5 5097 99.308 1 2816 2 chr1A.!!$F1 2815
5 TraesCS6B01G338600 chr3B 92326382 92329200 2818 False 5025.0 5025 98.865 1 2816 1 chr3B.!!$F1 2815
6 TraesCS6B01G338600 chr3A 694364213 694367026 2813 True 4966.0 4966 98.509 1 2816 1 chr3A.!!$R1 2815
7 TraesCS6B01G338600 chr2A 444292179 444294984 2805 True 4737.0 4737 97.090 1 2816 1 chr2A.!!$R1 2815

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
631 632 0.10212 CTTGACCCAGCGCAAAAACA 59.898 50.0 11.47 0.76 0.0 2.83 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2024 8027 2.094675 CACCATAGAAGGGCAACAAGG 58.905 52.381 0.0 0.0 39.74 3.61 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
26 27 6.984474 GTCATTTTCTATGAGTAATCGGTCCA 59.016 38.462 0.00 0.00 0.00 4.02
631 632 0.102120 CTTGACCCAGCGCAAAAACA 59.898 50.000 11.47 0.76 0.00 2.83
864 866 4.502259 GGACTTCAAAGCTCAGAAGAGACA 60.502 45.833 26.00 0.00 44.98 3.41
1308 1311 5.299949 AGTCATCAAATTTGGTGCTTTTCC 58.700 37.500 23.93 9.00 39.14 3.13
1651 1654 3.243267 GGTTTTTCCGCTTTTCACAGCTA 60.243 43.478 0.00 0.00 37.68 3.32
2024 8027 2.485657 GCCCTAACTGAGTCCATTAGCC 60.486 54.545 5.39 0.00 0.00 3.93
2408 12336 7.964604 AGTGAAAGAAGAAATAAAGTACGCT 57.035 32.000 0.00 0.00 0.00 5.07
2661 12589 5.888161 CCACTAGTGAGAAGGCCAATAAATT 59.112 40.000 24.68 0.00 0.00 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
58 59 4.379339 TTTTCACTACTTTTGGCCACAC 57.621 40.909 3.88 0.0 0.00 3.82
864 866 1.501582 GCCCTGATAGAAGTGGGACT 58.498 55.000 0.00 0.0 42.11 3.85
1651 1654 2.526046 CCGGGGGTGTGGAAAGAGT 61.526 63.158 0.00 0.0 0.00 3.24
2024 8027 2.094675 CACCATAGAAGGGCAACAAGG 58.905 52.381 0.00 0.0 39.74 3.61
2408 12336 8.114331 AGCTATGTGATTTTTCACTTTGATCA 57.886 30.769 7.55 0.0 40.97 2.92


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.