Multiple sequence alignment - TraesCS6B01G338500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G338500 chr6B 100.000 2487 0 0 1 2487 596620323 596622809 0 4593
1 TraesCS6B01G338500 chrUn 99.317 2488 15 2 1 2487 86510013 86507527 0 4499
2 TraesCS6B01G338500 chrUn 99.317 2488 15 2 1 2487 282364697 282362211 0 4499
3 TraesCS6B01G338500 chr3B 99.035 2487 21 3 1 2487 92317837 92320320 0 4457
4 TraesCS6B01G338500 chr2B 98.955 2488 19 6 1 2487 30670612 30668131 0 4444
5 TraesCS6B01G338500 chr6A 98.756 2491 26 3 1 2487 84434143 84436632 0 4423
6 TraesCS6B01G338500 chr3A 98.351 2487 39 2 1 2487 694375571 694373087 0 4364
7 TraesCS6B01G338500 chr4A 98.195 2493 35 6 1 2487 67576685 67574197 0 4346


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G338500 chr6B 596620323 596622809 2486 False 4593 4593 100.000 1 2487 1 chr6B.!!$F1 2486
1 TraesCS6B01G338500 chrUn 86507527 86510013 2486 True 4499 4499 99.317 1 2487 1 chrUn.!!$R1 2486
2 TraesCS6B01G338500 chrUn 282362211 282364697 2486 True 4499 4499 99.317 1 2487 1 chrUn.!!$R2 2486
3 TraesCS6B01G338500 chr3B 92317837 92320320 2483 False 4457 4457 99.035 1 2487 1 chr3B.!!$F1 2486
4 TraesCS6B01G338500 chr2B 30668131 30670612 2481 True 4444 4444 98.955 1 2487 1 chr2B.!!$R1 2486
5 TraesCS6B01G338500 chr6A 84434143 84436632 2489 False 4423 4423 98.756 1 2487 1 chr6A.!!$F1 2486
6 TraesCS6B01G338500 chr3A 694373087 694375571 2484 True 4364 4364 98.351 1 2487 1 chr3A.!!$R1 2486
7 TraesCS6B01G338500 chr4A 67574197 67576685 2488 True 4346 4346 98.195 1 2487 1 chr4A.!!$R1 2486

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1019 1023 0.743688 ATGGCTTTTGTGCAACGTCA 59.256 45.0 0.0 0.0 42.39 4.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2041 2049 2.541762 GCATGCTCTCTGATTTACGGAC 59.458 50.0 11.37 0.0 0.0 4.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1019 1023 0.743688 ATGGCTTTTGTGCAACGTCA 59.256 45.000 0.00 0.00 42.39 4.35
1178 1182 1.053424 TTAAGTCTGGTCGCTTGGGT 58.947 50.000 0.00 0.00 0.00 4.51
1573 1580 9.520515 TCACTATTGGAAATTCTAGCTTTCTTT 57.479 29.630 13.80 0.00 33.93 2.52
2328 2343 3.518998 CGGACTGGGATCGCTCGT 61.519 66.667 11.46 8.03 0.00 4.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1019 1023 2.308866 CCCACTACATCAGGACCCTTTT 59.691 50.000 0.00 0.0 0.00 2.27
1178 1182 7.281324 CCATACCATAATCAAAAGGTACAACGA 59.719 37.037 0.00 0.0 39.25 3.85
2041 2049 2.541762 GCATGCTCTCTGATTTACGGAC 59.458 50.000 11.37 0.0 0.00 4.79
2328 2343 2.848678 TTTCTAGAGGGCCTAGCTGA 57.151 50.000 5.73 0.0 43.60 4.26


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.