Multiple sequence alignment - TraesCS6B01G338400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G338400 chr6B 100.000 2235 0 0 1 2235 596601836 596604070 0 4128
1 TraesCS6B01G338400 chrUn 99.240 2236 15 2 1 2235 171008308 171006074 0 4034
2 TraesCS6B01G338400 chr7A 99.105 2234 17 3 1 2232 638507642 638509874 0 4012
3 TraesCS6B01G338400 chr7A 98.972 2237 19 3 1 2235 708245647 708243413 0 4000
4 TraesCS6B01G338400 chr1B 98.792 2236 23 4 1 2235 672541244 672539012 0 3976
5 TraesCS6B01G338400 chr5B 98.748 2237 26 2 1 2235 567280018 567277782 0 3975
6 TraesCS6B01G338400 chr7D 98.614 2236 24 3 1 2235 382089821 382087592 0 3951
7 TraesCS6B01G338400 chr7D 98.391 2238 25 4 1 2235 626711173 626713402 0 3923
8 TraesCS6B01G338400 chr2B 98.525 2238 30 2 1 2235 391225219 391227456 0 3947
9 TraesCS6B01G338400 chr3B 97.228 2237 56 4 1 2235 39877098 39874866 0 3783


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G338400 chr6B 596601836 596604070 2234 False 4128 4128 100.000 1 2235 1 chr6B.!!$F1 2234
1 TraesCS6B01G338400 chrUn 171006074 171008308 2234 True 4034 4034 99.240 1 2235 1 chrUn.!!$R1 2234
2 TraesCS6B01G338400 chr7A 638507642 638509874 2232 False 4012 4012 99.105 1 2232 1 chr7A.!!$F1 2231
3 TraesCS6B01G338400 chr7A 708243413 708245647 2234 True 4000 4000 98.972 1 2235 1 chr7A.!!$R1 2234
4 TraesCS6B01G338400 chr1B 672539012 672541244 2232 True 3976 3976 98.792 1 2235 1 chr1B.!!$R1 2234
5 TraesCS6B01G338400 chr5B 567277782 567280018 2236 True 3975 3975 98.748 1 2235 1 chr5B.!!$R1 2234
6 TraesCS6B01G338400 chr7D 382087592 382089821 2229 True 3951 3951 98.614 1 2235 1 chr7D.!!$R1 2234
7 TraesCS6B01G338400 chr7D 626711173 626713402 2229 False 3923 3923 98.391 1 2235 1 chr7D.!!$F1 2234
8 TraesCS6B01G338400 chr2B 391225219 391227456 2237 False 3947 3947 98.525 1 2235 1 chr2B.!!$F1 2234
9 TraesCS6B01G338400 chr3B 39874866 39877098 2232 True 3783 3783 97.228 1 2235 1 chr3B.!!$R1 2234

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
667 671 1.017177 GTCACCTGTAATCCGCGCAA 61.017 55.0 8.75 0.0 0.0 4.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1666 1673 2.041922 ATCCCAGAGTAGCCGCCA 60.042 61.111 0.0 0.0 0.0 5.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
667 671 1.017177 GTCACCTGTAATCCGCGCAA 61.017 55.000 8.75 0.0 0.00 4.85
1287 1294 1.340248 AGAGCGGTCTCGAGTTTTTCA 59.660 47.619 12.24 0.0 44.02 2.69
1487 1494 1.797025 GTAACCAGCTCTGCTTTCGT 58.203 50.000 0.00 0.0 36.40 3.85
1931 1943 1.480954 ACAATAAGGAGACGCGGTGAT 59.519 47.619 12.47 0.0 0.00 3.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1287 1294 0.757188 AATGCGATCTCGAGGACCCT 60.757 55.000 13.56 0.0 43.02 4.34
1666 1673 2.041922 ATCCCAGAGTAGCCGCCA 60.042 61.111 0.00 0.0 0.00 5.69
1931 1943 3.762407 TTTTCCTTCTGGATGACGACA 57.238 42.857 0.00 0.0 42.81 4.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.