Multiple sequence alignment - TraesCS6B01G338300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G338300 chr6B 100.000 3074 0 0 1 3074 596596237 596593164 0 5677
1 TraesCS6B01G338300 chr1D 99.154 3074 25 1 1 3074 212442239 212439167 0 5531
2 TraesCS6B01G338300 chrUn 98.959 3074 31 1 1 3074 171013907 171016979 0 5498
3 TraesCS6B01G338300 chr7B 98.731 3074 39 0 1 3074 54043561 54040488 0 5461
4 TraesCS6B01G338300 chr7B 97.723 3074 66 4 1 3074 47245610 47242541 0 5286
5 TraesCS6B01G338300 chr5B 98.601 3074 41 2 1 3074 567285592 567288663 0 5437
6 TraesCS6B01G338300 chr5B 97.983 3074 57 3 1 3074 680052970 680049902 0 5328


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G338300 chr6B 596593164 596596237 3073 True 5677 5677 100.000 1 3074 1 chr6B.!!$R1 3073
1 TraesCS6B01G338300 chr1D 212439167 212442239 3072 True 5531 5531 99.154 1 3074 1 chr1D.!!$R1 3073
2 TraesCS6B01G338300 chrUn 171013907 171016979 3072 False 5498 5498 98.959 1 3074 1 chrUn.!!$F1 3073
3 TraesCS6B01G338300 chr7B 54040488 54043561 3073 True 5461 5461 98.731 1 3074 1 chr7B.!!$R2 3073
4 TraesCS6B01G338300 chr7B 47242541 47245610 3069 True 5286 5286 97.723 1 3074 1 chr7B.!!$R1 3073
5 TraesCS6B01G338300 chr5B 567285592 567288663 3071 False 5437 5437 98.601 1 3074 1 chr5B.!!$F1 3073
6 TraesCS6B01G338300 chr5B 680049902 680052970 3068 True 5328 5328 97.983 1 3074 1 chr5B.!!$R1 3073

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
45 46 0.951558 GACCGGCTTTGCTTCTTTCA 59.048 50.0 0.00 0.0 0.00 2.69 F
1647 1649 5.759763 ACTCAAATCCAAGGAATTGCAAAAC 59.240 36.0 1.71 0.0 35.61 2.43 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1985 1987 4.694339 GTGAGGGATGTGACCTATGTTAC 58.306 47.826 0.0 0.0 38.79 2.50 R
2970 2972 4.063998 TCCTTACTACGTCTATCGCTCA 57.936 45.455 0.0 0.0 44.19 4.26 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
45 46 0.951558 GACCGGCTTTGCTTCTTTCA 59.048 50.000 0.00 0.0 0.00 2.69
1647 1649 5.759763 ACTCAAATCCAAGGAATTGCAAAAC 59.240 36.000 1.71 0.0 35.61 2.43
1985 1987 3.735237 AGCTGTGGTATCTTATGGACG 57.265 47.619 0.00 0.0 0.00 4.79
2053 2055 1.183030 TCCTCTTCGGAGCGGAAACA 61.183 55.000 0.00 0.0 40.56 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
45 46 7.050377 AGTGAATTCCAATCTACGTGAATCAT 58.950 34.615 2.27 0.0 0.00 2.45
1985 1987 4.694339 GTGAGGGATGTGACCTATGTTAC 58.306 47.826 0.00 0.0 38.79 2.50
2053 2055 5.968528 TTTTATATGTTTTGGCCACGTCT 57.031 34.783 3.88 0.0 0.00 4.18
2970 2972 4.063998 TCCTTACTACGTCTATCGCTCA 57.936 45.455 0.00 0.0 44.19 4.26


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.