Multiple sequence alignment - TraesCS6B01G334200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G334200 chr6B 100.000 2924 0 0 1 2924 586281838 586278915 0 5400
1 TraesCS6B01G334200 chr1B 98.427 2924 46 0 1 2924 26649580 26652503 0 5145
2 TraesCS6B01G334200 chr3B 98.393 2924 47 0 1 2924 717600181 717597258 0 5140
3 TraesCS6B01G334200 chr2B 98.390 2919 46 1 1 2918 106932289 106935207 0 5129
4 TraesCS6B01G334200 chr2B 98.324 2924 48 1 1 2924 563765234 563768156 0 5127
5 TraesCS6B01G334200 chr2B 98.154 2925 53 1 1 2924 327771513 327768589 0 5101
6 TraesCS6B01G334200 chr2B 98.119 2924 54 1 1 2924 257723647 257720725 0 5094
7 TraesCS6B01G334200 chr2B 97.982 2924 59 0 1 2924 63584153 63587076 0 5073
8 TraesCS6B01G334200 chr5B 98.291 2925 49 1 1 2924 36453480 36450556 0 5123
9 TraesCS6B01G334200 chr4B 98.222 2925 49 3 1 2924 11627560 11624638 0 5110


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G334200 chr6B 586278915 586281838 2923 True 5400 5400 100.000 1 2924 1 chr6B.!!$R1 2923
1 TraesCS6B01G334200 chr1B 26649580 26652503 2923 False 5145 5145 98.427 1 2924 1 chr1B.!!$F1 2923
2 TraesCS6B01G334200 chr3B 717597258 717600181 2923 True 5140 5140 98.393 1 2924 1 chr3B.!!$R1 2923
3 TraesCS6B01G334200 chr2B 106932289 106935207 2918 False 5129 5129 98.390 1 2918 1 chr2B.!!$F2 2917
4 TraesCS6B01G334200 chr2B 563765234 563768156 2922 False 5127 5127 98.324 1 2924 1 chr2B.!!$F3 2923
5 TraesCS6B01G334200 chr2B 327768589 327771513 2924 True 5101 5101 98.154 1 2924 1 chr2B.!!$R2 2923
6 TraesCS6B01G334200 chr2B 257720725 257723647 2922 True 5094 5094 98.119 1 2924 1 chr2B.!!$R1 2923
7 TraesCS6B01G334200 chr2B 63584153 63587076 2923 False 5073 5073 97.982 1 2924 1 chr2B.!!$F1 2923
8 TraesCS6B01G334200 chr5B 36450556 36453480 2924 True 5123 5123 98.291 1 2924 1 chr5B.!!$R1 2923
9 TraesCS6B01G334200 chr4B 11624638 11627560 2922 True 5110 5110 98.222 1 2924 1 chr4B.!!$R1 2923

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
355 356 0.978907 TCAGGAACTCTGCATGCTGA 59.021 50.000 23.75 23.75 43.06 4.26 F
1137 1138 1.380380 CTTCCTGCCATCCCAACCC 60.380 63.158 0.00 0.00 0.00 4.11 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1189 1190 0.535102 CTTCCGTTCCCAACAGCAGT 60.535 55.000 0.0 0.0 0.0 4.40 R
2317 2320 3.788227 ACAACAACATGGCTTCCTCTA 57.212 42.857 0.0 0.0 0.0 2.43 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
176 177 5.708697 ACAGTGATCCATATACATGCCATTG 59.291 40.000 0.00 0.00 0.00 2.82
250 251 4.567597 ACCACCGGGACCTCCACA 62.568 66.667 6.32 0.00 37.91 4.17
355 356 0.978907 TCAGGAACTCTGCATGCTGA 59.021 50.000 23.75 23.75 43.06 4.26
640 641 3.445096 GCTTCATCCATAAGTGGCAAACT 59.555 43.478 0.00 0.00 45.63 2.66
742 743 8.664992 TCAATTCTTGGGCAATATATGGTAGTA 58.335 33.333 0.00 0.00 0.00 1.82
1059 1060 8.786826 TTGGTTCAGTTTCGTATATTCTTCAT 57.213 30.769 0.00 0.00 0.00 2.57
1110 1111 3.748048 GCTCTGCTCATGTTGTTAGACAA 59.252 43.478 0.00 0.00 35.42 3.18
1137 1138 1.380380 CTTCCTGCCATCCCAACCC 60.380 63.158 0.00 0.00 0.00 4.11
1189 1190 1.829222 GGCAGTAGCACCAGTACCTTA 59.171 52.381 0.00 0.00 44.61 2.69
1233 1234 4.529897 AGCTGTTCCATGCATTGAATCTA 58.470 39.130 15.53 5.89 0.00 1.98
1291 1292 4.789075 CATGCTTGTGCCGCTGCC 62.789 66.667 0.00 0.00 38.71 4.85
1696 1698 7.208777 TCGTATGCATAGGTTTATTCGGTTTA 58.791 34.615 22.18 0.02 0.00 2.01
1834 1836 1.024271 CTTGGATGCATTGGTACCCG 58.976 55.000 10.07 0.00 0.00 5.28
1843 1845 1.136305 CATTGGTACCCGTCATCGAGT 59.864 52.381 10.07 0.00 39.71 4.18
2317 2320 8.812513 TTTTCTGATTCATGTAACAGGATGAT 57.187 30.769 9.24 0.00 39.69 2.45
2918 2923 5.590259 CCCATGTAGAAAATCGAATTGGACT 59.410 40.000 0.00 0.00 0.00 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
176 177 6.295039 TCATTTCAGAGAACGTTAAACACC 57.705 37.500 0.00 0.0 0.00 4.16
250 251 1.094073 GTGCAGGCTTCATCATCGCT 61.094 55.000 0.00 0.0 0.00 4.93
355 356 7.628234 AGTTAAGATGATGAGACAAAGGACAT 58.372 34.615 0.00 0.0 0.00 3.06
440 441 0.614415 TGGGCGGCCAAGAAATGAAT 60.614 50.000 30.86 0.0 0.00 2.57
667 668 3.625853 TCAACTCCATTGGTTGTCACAA 58.374 40.909 1.86 0.0 42.97 3.33
742 743 0.036010 CTTGGGCGTGAAGAGTGGAT 60.036 55.000 0.00 0.0 0.00 3.41
1059 1060 6.270927 AGTTATAAGCATGATAGAAGGCTGGA 59.729 38.462 0.00 0.0 36.58 3.86
1110 1111 3.359950 GGATGGCAGGAAGTGAAAATCT 58.640 45.455 0.00 0.0 0.00 2.40
1189 1190 0.535102 CTTCCGTTCCCAACAGCAGT 60.535 55.000 0.00 0.0 0.00 4.40
1291 1292 2.434884 ACATGTTGAGGCCGAGCG 60.435 61.111 0.00 0.0 0.00 5.03
1834 1836 0.924090 GCATCCGTTCACTCGATGAC 59.076 55.000 0.00 0.0 36.92 3.06
1843 1845 2.324330 CCGCTGTTGCATCCGTTCA 61.324 57.895 0.00 0.0 39.64 3.18
2317 2320 3.788227 ACAACAACATGGCTTCCTCTA 57.212 42.857 0.00 0.0 0.00 2.43
2576 2580 7.285566 ACAAGAGCAACCAGATCACATAATAT 58.714 34.615 0.00 0.0 34.30 1.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.